ID: 1049223259

View in Genome Browser
Species Human (GRCh38)
Location 8:141437242-141437264
Sequence CCGTGGGGAGCTGTGGGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223237_1049223259 23 Left 1049223237 8:141437196-141437218 CCCTGCCCGCCGTGGGGAGCTGT No data
Right 1049223259 8:141437242-141437264 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223243_1049223259 14 Left 1049223243 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG No data
Right 1049223259 8:141437242-141437264 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223251_1049223259 -9 Left 1049223251 8:141437228-141437250 CCTGGCCCTGCCCGCCGTGGGGA No data
Right 1049223259 8:141437242-141437264 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223242_1049223259 17 Left 1049223242 8:141437202-141437224 CCGCCGTGGGGAGCTGTGGGTCC No data
Right 1049223259 8:141437242-141437264 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223241_1049223259 18 Left 1049223241 8:141437201-141437223 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223259 8:141437242-141437264 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223238_1049223259 22 Left 1049223238 8:141437197-141437219 CCTGCCCGCCGTGGGGAGCTGTG No data
Right 1049223259 8:141437242-141437264 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223247_1049223259 -5 Left 1049223247 8:141437224-141437246 CCGGCCTGGCCCTGCCCGCCGTG No data
Right 1049223259 8:141437242-141437264 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223246_1049223259 -4 Left 1049223246 8:141437223-141437245 CCCGGCCTGGCCCTGCCCGCCGT No data
Right 1049223259 8:141437242-141437264 CCGTGGGGAGCTGTGGGTCCCGG No data
1049223236_1049223259 28 Left 1049223236 8:141437191-141437213 CCTGGCCCTGCCCGCCGTGGGGA No data
Right 1049223259 8:141437242-141437264 CCGTGGGGAGCTGTGGGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223259 Original CRISPR CCGTGGGGAGCTGTGGGTCC CGG Intergenic
No off target data available for this crispr