ID: 1049223260

View in Genome Browser
Species Human (GRCh38)
Location 8:141437247-141437269
Sequence GGGAGCTGTGGGTCCCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223242_1049223260 22 Left 1049223242 8:141437202-141437224 CCGCCGTGGGGAGCTGTGGGTCC No data
Right 1049223260 8:141437247-141437269 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223253_1049223260 -10 Left 1049223253 8:141437234-141437256 CCTGCCCGCCGTGGGGAGCTGTG No data
Right 1049223260 8:141437247-141437269 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223247_1049223260 0 Left 1049223247 8:141437224-141437246 CCGGCCTGGCCCTGCCCGCCGTG No data
Right 1049223260 8:141437247-141437269 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223252_1049223260 -9 Left 1049223252 8:141437233-141437255 CCCTGCCCGCCGTGGGGAGCTGT No data
Right 1049223260 8:141437247-141437269 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223237_1049223260 28 Left 1049223237 8:141437196-141437218 CCCTGCCCGCCGTGGGGAGCTGT No data
Right 1049223260 8:141437247-141437269 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223243_1049223260 19 Left 1049223243 8:141437205-141437227 CCGTGGGGAGCTGTGGGTCCCGG No data
Right 1049223260 8:141437247-141437269 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223238_1049223260 27 Left 1049223238 8:141437197-141437219 CCTGCCCGCCGTGGGGAGCTGTG No data
Right 1049223260 8:141437247-141437269 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223241_1049223260 23 Left 1049223241 8:141437201-141437223 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223260 8:141437247-141437269 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223246_1049223260 1 Left 1049223246 8:141437223-141437245 CCCGGCCTGGCCCTGCCCGCCGT No data
Right 1049223260 8:141437247-141437269 GGGAGCTGTGGGTCCCGGCCTGG No data
1049223251_1049223260 -4 Left 1049223251 8:141437228-141437250 CCTGGCCCTGCCCGCCGTGGGGA No data
Right 1049223260 8:141437247-141437269 GGGAGCTGTGGGTCCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223260 Original CRISPR GGGAGCTGTGGGTCCCGGCC TGG Intergenic
No off target data available for this crispr