ID: 1049223271

View in Genome Browser
Species Human (GRCh38)
Location 8:141437275-141437297
Sequence GACCCACAGCTCCCCACGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223271_1049223286 21 Left 1049223271 8:141437275-141437297 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223286 8:141437319-141437341 TGGGGAGCTGTGCCCCTAACTGG No data
1049223271_1049223277 1 Left 1049223271 8:141437275-141437297 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223277 8:141437299-141437321 TGGCCTGGCCCTGCCCGCCGTGG No data
1049223271_1049223279 3 Left 1049223271 8:141437275-141437297 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223279 8:141437301-141437323 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223271_1049223278 2 Left 1049223271 8:141437275-141437297 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223278 8:141437300-141437322 GGCCTGGCCCTGCCCGCCGTGGG No data
1049223271_1049223287 22 Left 1049223271 8:141437275-141437297 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223287 8:141437320-141437342 GGGGAGCTGTGCCCCTAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223271 Original CRISPR GACCCACAGCTCCCCACGGC GGG (reversed) Intergenic
No off target data available for this crispr