ID: 1049223277

View in Genome Browser
Species Human (GRCh38)
Location 8:141437299-141437321
Sequence TGGCCTGGCCCTGCCCGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223271_1049223277 1 Left 1049223271 8:141437275-141437297 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223277 8:141437299-141437321 TGGCCTGGCCCTGCCCGCCGTGG No data
1049223267_1049223277 6 Left 1049223267 8:141437270-141437292 CCCTGCCCGCCGTGGGGAGCTGT No data
Right 1049223277 8:141437299-141437321 TGGCCTGGCCCTGCCCGCCGTGG No data
1049223262_1049223277 15 Left 1049223262 8:141437261-141437283 CCGGCCTGGCCCTGCCCGCCGTG No data
Right 1049223277 8:141437299-141437321 TGGCCTGGCCCTGCCCGCCGTGG No data
1049223261_1049223277 16 Left 1049223261 8:141437260-141437282 CCCGGCCTGGCCCTGCCCGCCGT No data
Right 1049223277 8:141437299-141437321 TGGCCTGGCCCTGCCCGCCGTGG No data
1049223273_1049223277 -3 Left 1049223273 8:141437279-141437301 CCGTGGGGAGCTGTGGGTCCTGG No data
Right 1049223277 8:141437299-141437321 TGGCCTGGCCCTGCCCGCCGTGG No data
1049223266_1049223277 11 Left 1049223266 8:141437265-141437287 CCTGGCCCTGCCCGCCGTGGGGA No data
Right 1049223277 8:141437299-141437321 TGGCCTGGCCCTGCCCGCCGTGG No data
1049223268_1049223277 5 Left 1049223268 8:141437271-141437293 CCTGCCCGCCGTGGGGAGCTGTG No data
Right 1049223277 8:141437299-141437321 TGGCCTGGCCCTGCCCGCCGTGG No data
1049223272_1049223277 0 Left 1049223272 8:141437276-141437298 CCGCCGTGGGGAGCTGTGGGTCC No data
Right 1049223277 8:141437299-141437321 TGGCCTGGCCCTGCCCGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223277 Original CRISPR TGGCCTGGCCCTGCCCGCCG TGG Intergenic
No off target data available for this crispr