ID: 1049223279

View in Genome Browser
Species Human (GRCh38)
Location 8:141437301-141437323
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223262_1049223279 17 Left 1049223262 8:141437261-141437283 CCGGCCTGGCCCTGCCCGCCGTG No data
Right 1049223279 8:141437301-141437323 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223267_1049223279 8 Left 1049223267 8:141437270-141437292 CCCTGCCCGCCGTGGGGAGCTGT No data
Right 1049223279 8:141437301-141437323 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223261_1049223279 18 Left 1049223261 8:141437260-141437282 CCCGGCCTGGCCCTGCCCGCCGT No data
Right 1049223279 8:141437301-141437323 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223268_1049223279 7 Left 1049223268 8:141437271-141437293 CCTGCCCGCCGTGGGGAGCTGTG No data
Right 1049223279 8:141437301-141437323 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223266_1049223279 13 Left 1049223266 8:141437265-141437287 CCTGGCCCTGCCCGCCGTGGGGA No data
Right 1049223279 8:141437301-141437323 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223273_1049223279 -1 Left 1049223273 8:141437279-141437301 CCGTGGGGAGCTGTGGGTCCTGG No data
Right 1049223279 8:141437301-141437323 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223271_1049223279 3 Left 1049223271 8:141437275-141437297 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223279 8:141437301-141437323 GCCTGGCCCTGCCCGCCGTGGGG No data
1049223272_1049223279 2 Left 1049223272 8:141437276-141437298 CCGCCGTGGGGAGCTGTGGGTCC No data
Right 1049223279 8:141437301-141437323 GCCTGGCCCTGCCCGCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223279 Original CRISPR GCCTGGCCCTGCCCGCCGTG GGG Intergenic
No off target data available for this crispr