ID: 1049223286

View in Genome Browser
Species Human (GRCh38)
Location 8:141437319-141437341
Sequence TGGGGAGCTGTGCCCCTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223280_1049223286 -6 Left 1049223280 8:141437302-141437324 CCTGGCCCTGCCCGCCGTGGGGA No data
Right 1049223286 8:141437319-141437341 TGGGGAGCTGTGCCCCTAACTGG No data
1049223272_1049223286 20 Left 1049223272 8:141437276-141437298 CCGCCGTGGGGAGCTGTGGGTCC No data
Right 1049223286 8:141437319-141437341 TGGGGAGCTGTGCCCCTAACTGG No data
1049223267_1049223286 26 Left 1049223267 8:141437270-141437292 CCCTGCCCGCCGTGGGGAGCTGT No data
Right 1049223286 8:141437319-141437341 TGGGGAGCTGTGCCCCTAACTGG No data
1049223273_1049223286 17 Left 1049223273 8:141437279-141437301 CCGTGGGGAGCTGTGGGTCCTGG No data
Right 1049223286 8:141437319-141437341 TGGGGAGCTGTGCCCCTAACTGG No data
1049223271_1049223286 21 Left 1049223271 8:141437275-141437297 CCCGCCGTGGGGAGCTGTGGGTC No data
Right 1049223286 8:141437319-141437341 TGGGGAGCTGTGCCCCTAACTGG No data
1049223268_1049223286 25 Left 1049223268 8:141437271-141437293 CCTGCCCGCCGTGGGGAGCTGTG No data
Right 1049223286 8:141437319-141437341 TGGGGAGCTGTGCCCCTAACTGG No data
1049223276_1049223286 -1 Left 1049223276 8:141437297-141437319 CCTGGCCTGGCCCTGCCCGCCGT No data
Right 1049223286 8:141437319-141437341 TGGGGAGCTGTGCCCCTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223286 Original CRISPR TGGGGAGCTGTGCCCCTAAC TGG Intergenic
No off target data available for this crispr