ID: 1049223892

View in Genome Browser
Species Human (GRCh38)
Location 8:141440606-141440628
Sequence CTCGGCTCTTGATAAAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223892_1049223900 -4 Left 1049223892 8:141440606-141440628 CCTCACTTTTATCAAGAGCCGAG No data
Right 1049223900 8:141440625-141440647 CGAGCTTGTGGGGCACCTGGGGG No data
1049223892_1049223904 14 Left 1049223892 8:141440606-141440628 CCTCACTTTTATCAAGAGCCGAG No data
Right 1049223904 8:141440643-141440665 GGGGGTAGAGCGCCCATGGAGGG No data
1049223892_1049223901 10 Left 1049223892 8:141440606-141440628 CCTCACTTTTATCAAGAGCCGAG No data
Right 1049223901 8:141440639-141440661 ACCTGGGGGTAGAGCGCCCATGG No data
1049223892_1049223897 -6 Left 1049223892 8:141440606-141440628 CCTCACTTTTATCAAGAGCCGAG No data
Right 1049223897 8:141440623-141440645 GCCGAGCTTGTGGGGCACCTGGG No data
1049223892_1049223899 -5 Left 1049223892 8:141440606-141440628 CCTCACTTTTATCAAGAGCCGAG No data
Right 1049223899 8:141440624-141440646 CCGAGCTTGTGGGGCACCTGGGG No data
1049223892_1049223903 13 Left 1049223892 8:141440606-141440628 CCTCACTTTTATCAAGAGCCGAG No data
Right 1049223903 8:141440642-141440664 TGGGGGTAGAGCGCCCATGGAGG No data
1049223892_1049223909 30 Left 1049223892 8:141440606-141440628 CCTCACTTTTATCAAGAGCCGAG No data
Right 1049223909 8:141440659-141440681 TGGAGGGCGGCCTAGGCAGCTGG No data
1049223892_1049223896 -7 Left 1049223892 8:141440606-141440628 CCTCACTTTTATCAAGAGCCGAG No data
Right 1049223896 8:141440622-141440644 AGCCGAGCTTGTGGGGCACCTGG No data
1049223892_1049223905 17 Left 1049223892 8:141440606-141440628 CCTCACTTTTATCAAGAGCCGAG No data
Right 1049223905 8:141440646-141440668 GGTAGAGCGCCCATGGAGGGCGG No data
1049223892_1049223906 23 Left 1049223892 8:141440606-141440628 CCTCACTTTTATCAAGAGCCGAG No data
Right 1049223906 8:141440652-141440674 GCGCCCATGGAGGGCGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223892 Original CRISPR CTCGGCTCTTGATAAAAGTG AGG (reversed) Intergenic
No off target data available for this crispr