ID: 1049223898

View in Genome Browser
Species Human (GRCh38)
Location 8:141440624-141440646
Sequence CCCCAGGTGCCCCACAAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223898_1049223903 -5 Left 1049223898 8:141440624-141440646 CCGAGCTTGTGGGGCACCTGGGG No data
Right 1049223903 8:141440642-141440664 TGGGGGTAGAGCGCCCATGGAGG No data
1049223898_1049223912 19 Left 1049223898 8:141440624-141440646 CCGAGCTTGTGGGGCACCTGGGG No data
Right 1049223912 8:141440666-141440688 CGGCCTAGGCAGCTGGTGGGTGG No data
1049223898_1049223911 16 Left 1049223898 8:141440624-141440646 CCGAGCTTGTGGGGCACCTGGGG No data
Right 1049223911 8:141440663-141440685 GGGCGGCCTAGGCAGCTGGTGGG No data
1049223898_1049223910 15 Left 1049223898 8:141440624-141440646 CCGAGCTTGTGGGGCACCTGGGG No data
Right 1049223910 8:141440662-141440684 AGGGCGGCCTAGGCAGCTGGTGG No data
1049223898_1049223909 12 Left 1049223898 8:141440624-141440646 CCGAGCTTGTGGGGCACCTGGGG No data
Right 1049223909 8:141440659-141440681 TGGAGGGCGGCCTAGGCAGCTGG No data
1049223898_1049223905 -1 Left 1049223898 8:141440624-141440646 CCGAGCTTGTGGGGCACCTGGGG No data
Right 1049223905 8:141440646-141440668 GGTAGAGCGCCCATGGAGGGCGG No data
1049223898_1049223904 -4 Left 1049223898 8:141440624-141440646 CCGAGCTTGTGGGGCACCTGGGG No data
Right 1049223904 8:141440643-141440665 GGGGGTAGAGCGCCCATGGAGGG No data
1049223898_1049223906 5 Left 1049223898 8:141440624-141440646 CCGAGCTTGTGGGGCACCTGGGG No data
Right 1049223906 8:141440652-141440674 GCGCCCATGGAGGGCGGCCTAGG No data
1049223898_1049223913 20 Left 1049223898 8:141440624-141440646 CCGAGCTTGTGGGGCACCTGGGG No data
Right 1049223913 8:141440667-141440689 GGCCTAGGCAGCTGGTGGGTGGG No data
1049223898_1049223901 -8 Left 1049223898 8:141440624-141440646 CCGAGCTTGTGGGGCACCTGGGG No data
Right 1049223901 8:141440639-141440661 ACCTGGGGGTAGAGCGCCCATGG No data
1049223898_1049223915 26 Left 1049223898 8:141440624-141440646 CCGAGCTTGTGGGGCACCTGGGG No data
Right 1049223915 8:141440673-141440695 GGCAGCTGGTGGGTGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223898 Original CRISPR CCCCAGGTGCCCCACAAGCT CGG (reversed) Intergenic
No off target data available for this crispr