ID: 1049223901

View in Genome Browser
Species Human (GRCh38)
Location 8:141440639-141440661
Sequence ACCTGGGGGTAGAGCGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049223892_1049223901 10 Left 1049223892 8:141440606-141440628 CCTCACTTTTATCAAGAGCCGAG No data
Right 1049223901 8:141440639-141440661 ACCTGGGGGTAGAGCGCCCATGG No data
1049223898_1049223901 -8 Left 1049223898 8:141440624-141440646 CCGAGCTTGTGGGGCACCTGGGG No data
Right 1049223901 8:141440639-141440661 ACCTGGGGGTAGAGCGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049223901 Original CRISPR ACCTGGGGGTAGAGCGCCCA TGG Intergenic
No off target data available for this crispr