ID: 1049224213

View in Genome Browser
Species Human (GRCh38)
Location 8:141441912-141441934
Sequence CAGGAGGGAGTAGCCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049224213_1049224227 17 Left 1049224213 8:141441912-141441934 CCCCCTGGGGCTACTCCCTCCTG No data
Right 1049224227 8:141441952-141441974 ATGCTGGGACCCAGGATTGGCGG No data
1049224213_1049224229 24 Left 1049224213 8:141441912-141441934 CCCCCTGGGGCTACTCCCTCCTG No data
Right 1049224229 8:141441959-141441981 GACCCAGGATTGGCGGAGCCGGG No data
1049224213_1049224224 2 Left 1049224213 8:141441912-141441934 CCCCCTGGGGCTACTCCCTCCTG No data
Right 1049224224 8:141441937-141441959 CTGTTTTACGCGGAAATGCTGGG No data
1049224213_1049224226 14 Left 1049224213 8:141441912-141441934 CCCCCTGGGGCTACTCCCTCCTG No data
Right 1049224226 8:141441949-141441971 GAAATGCTGGGACCCAGGATTGG No data
1049224213_1049224218 -8 Left 1049224213 8:141441912-141441934 CCCCCTGGGGCTACTCCCTCCTG No data
Right 1049224218 8:141441927-141441949 CCCTCCTGCCCTGTTTTACGCGG No data
1049224213_1049224223 1 Left 1049224213 8:141441912-141441934 CCCCCTGGGGCTACTCCCTCCTG No data
Right 1049224223 8:141441936-141441958 CCTGTTTTACGCGGAAATGCTGG No data
1049224213_1049224228 23 Left 1049224213 8:141441912-141441934 CCCCCTGGGGCTACTCCCTCCTG No data
Right 1049224228 8:141441958-141441980 GGACCCAGGATTGGCGGAGCCGG No data
1049224213_1049224225 9 Left 1049224213 8:141441912-141441934 CCCCCTGGGGCTACTCCCTCCTG No data
Right 1049224225 8:141441944-141441966 ACGCGGAAATGCTGGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049224213 Original CRISPR CAGGAGGGAGTAGCCCCAGG GGG (reversed) Intergenic
No off target data available for this crispr