ID: 1049224489

View in Genome Browser
Species Human (GRCh38)
Location 8:141443326-141443348
Sequence GCAACGACGTTGAGACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049224489_1049224490 -4 Left 1049224489 8:141443326-141443348 CCTGCTGGTCTCAACGTCGTTGC No data
Right 1049224490 8:141443345-141443367 TTGCCTGCCTGCAGCCTCTTTGG No data
1049224489_1049224493 4 Left 1049224489 8:141443326-141443348 CCTGCTGGTCTCAACGTCGTTGC No data
Right 1049224493 8:141443353-141443375 CTGCAGCCTCTTTGGACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049224489 Original CRISPR GCAACGACGTTGAGACCAGC AGG (reversed) Intergenic
No off target data available for this crispr