ID: 1049225153

View in Genome Browser
Species Human (GRCh38)
Location 8:141447044-141447066
Sequence CTCTACAGATGAGGCAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049225153_1049225157 12 Left 1049225153 8:141447044-141447066 CCTCAGTTGCCTCATCTGTAGAG No data
Right 1049225157 8:141447079-141447101 CATTCATCTCGAGTCCTCGCAGG No data
1049225153_1049225160 25 Left 1049225153 8:141447044-141447066 CCTCAGTTGCCTCATCTGTAGAG No data
Right 1049225160 8:141447092-141447114 TCCTCGCAGGAAACCCACTGGGG No data
1049225153_1049225159 24 Left 1049225153 8:141447044-141447066 CCTCAGTTGCCTCATCTGTAGAG No data
Right 1049225159 8:141447091-141447113 GTCCTCGCAGGAAACCCACTGGG No data
1049225153_1049225158 23 Left 1049225153 8:141447044-141447066 CCTCAGTTGCCTCATCTGTAGAG No data
Right 1049225158 8:141447090-141447112 AGTCCTCGCAGGAAACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049225153 Original CRISPR CTCTACAGATGAGGCAACTG AGG (reversed) Intergenic
No off target data available for this crispr