ID: 1049225156

View in Genome Browser
Species Human (GRCh38)
Location 8:141447053-141447075
Sequence TTGTCCCTGCTCTACAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049225156_1049225158 14 Left 1049225156 8:141447053-141447075 CCTCATCTGTAGAGCAGGGACAA No data
Right 1049225158 8:141447090-141447112 AGTCCTCGCAGGAAACCCACTGG No data
1049225156_1049225160 16 Left 1049225156 8:141447053-141447075 CCTCATCTGTAGAGCAGGGACAA No data
Right 1049225160 8:141447092-141447114 TCCTCGCAGGAAACCCACTGGGG No data
1049225156_1049225159 15 Left 1049225156 8:141447053-141447075 CCTCATCTGTAGAGCAGGGACAA No data
Right 1049225159 8:141447091-141447113 GTCCTCGCAGGAAACCCACTGGG No data
1049225156_1049225157 3 Left 1049225156 8:141447053-141447075 CCTCATCTGTAGAGCAGGGACAA No data
Right 1049225157 8:141447079-141447101 CATTCATCTCGAGTCCTCGCAGG No data
1049225156_1049225162 26 Left 1049225156 8:141447053-141447075 CCTCATCTGTAGAGCAGGGACAA No data
Right 1049225162 8:141447102-141447124 AAACCCACTGGGGTAAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049225156 Original CRISPR TTGTCCCTGCTCTACAGATG AGG (reversed) Intergenic
No off target data available for this crispr