ID: 1049225158

View in Genome Browser
Species Human (GRCh38)
Location 8:141447090-141447112
Sequence AGTCCTCGCAGGAAACCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049225156_1049225158 14 Left 1049225156 8:141447053-141447075 CCTCATCTGTAGAGCAGGGACAA No data
Right 1049225158 8:141447090-141447112 AGTCCTCGCAGGAAACCCACTGG No data
1049225153_1049225158 23 Left 1049225153 8:141447044-141447066 CCTCAGTTGCCTCATCTGTAGAG No data
Right 1049225158 8:141447090-141447112 AGTCCTCGCAGGAAACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049225158 Original CRISPR AGTCCTCGCAGGAAACCCAC TGG Intergenic
No off target data available for this crispr