ID: 1049225261

View in Genome Browser
Species Human (GRCh38)
Location 8:141447707-141447729
Sequence GGTTTCAGGGGAGCACGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049225245_1049225261 30 Left 1049225245 8:141447654-141447676 CCAGCGTGGCCATGAGACACTGG No data
Right 1049225261 8:141447707-141447729 GGTTTCAGGGGAGCACGCCCTGG No data
1049225249_1049225261 21 Left 1049225249 8:141447663-141447685 CCATGAGACACTGGGAACCGGAA No data
Right 1049225261 8:141447707-141447729 GGTTTCAGGGGAGCACGCCCTGG No data
1049225252_1049225261 4 Left 1049225252 8:141447680-141447702 CCGGAAGCAGTGAGGAAGGCCCC No data
Right 1049225261 8:141447707-141447729 GGTTTCAGGGGAGCACGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049225261 Original CRISPR GGTTTCAGGGGAGCACGCCC TGG Intergenic
No off target data available for this crispr