ID: 1049227840

View in Genome Browser
Species Human (GRCh38)
Location 8:141466230-141466252
Sequence TGCCTCCCATGTGCCCGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049227835_1049227840 29 Left 1049227835 8:141466178-141466200 CCTGGCTGGGGCAGGTGTTTCAT No data
Right 1049227840 8:141466230-141466252 TGCCTCCCATGTGCCCGCCCAGG No data
1049227839_1049227840 0 Left 1049227839 8:141466207-141466229 CCAGGACAGGAGACAGTGAGCAG No data
Right 1049227840 8:141466230-141466252 TGCCTCCCATGTGCCCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049227840 Original CRISPR TGCCTCCCATGTGCCCGCCC AGG Intergenic