ID: 1049229041

View in Genome Browser
Species Human (GRCh38)
Location 8:141472698-141472720
Sequence CCTGGAGGCGGGTGTCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049229028_1049229041 15 Left 1049229028 8:141472660-141472682 CCCGGCTGTGCTGTCGGGTATTC No data
Right 1049229041 8:141472698-141472720 CCTGGAGGCGGGTGTCCAGGGGG No data
1049229025_1049229041 30 Left 1049229025 8:141472645-141472667 CCAGTCAATATGGAGCCCGGCTG No data
Right 1049229041 8:141472698-141472720 CCTGGAGGCGGGTGTCCAGGGGG No data
1049229029_1049229041 14 Left 1049229029 8:141472661-141472683 CCGGCTGTGCTGTCGGGTATTCA No data
Right 1049229041 8:141472698-141472720 CCTGGAGGCGGGTGTCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049229041 Original CRISPR CCTGGAGGCGGGTGTCCAGG GGG Intergenic