ID: 1049229930

View in Genome Browser
Species Human (GRCh38)
Location 8:141476740-141476762
Sequence GCTCTTGCCTGAGCGAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049229930_1049229940 21 Left 1049229930 8:141476740-141476762 CCCCACCTCGCTCAGGCAAGAGC No data
Right 1049229940 8:141476784-141476806 ACGACCTTCCCCGTGGCTCCCGG No data
1049229930_1049229941 22 Left 1049229930 8:141476740-141476762 CCCCACCTCGCTCAGGCAAGAGC No data
Right 1049229941 8:141476785-141476807 CGACCTTCCCCGTGGCTCCCGGG No data
1049229930_1049229942 23 Left 1049229930 8:141476740-141476762 CCCCACCTCGCTCAGGCAAGAGC No data
Right 1049229942 8:141476786-141476808 GACCTTCCCCGTGGCTCCCGGGG No data
1049229930_1049229934 -2 Left 1049229930 8:141476740-141476762 CCCCACCTCGCTCAGGCAAGAGC No data
Right 1049229934 8:141476761-141476783 GCCAGTGCCCTGCAGTAGCCTGG No data
1049229930_1049229938 14 Left 1049229930 8:141476740-141476762 CCCCACCTCGCTCAGGCAAGAGC No data
Right 1049229938 8:141476777-141476799 AGCCTGGACGACCTTCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049229930 Original CRISPR GCTCTTGCCTGAGCGAGGTG GGG (reversed) Intergenic
No off target data available for this crispr