ID: 1049229943

View in Genome Browser
Species Human (GRCh38)
Location 8:141476788-141476810
Sequence GGCCCCGGGAGCCACGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049229943_1049229956 16 Left 1049229943 8:141476788-141476810 CCTTCCCCGTGGCTCCCGGGGCC No data
Right 1049229956 8:141476827-141476849 CTGCCACCCTGGCCCTCTGCGGG No data
1049229943_1049229955 15 Left 1049229943 8:141476788-141476810 CCTTCCCCGTGGCTCCCGGGGCC No data
Right 1049229955 8:141476826-141476848 CCTGCCACCCTGGCCCTCTGCGG No data
1049229943_1049229952 5 Left 1049229943 8:141476788-141476810 CCTTCCCCGTGGCTCCCGGGGCC No data
Right 1049229952 8:141476816-141476838 GCATTCCAGTCCTGCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049229943 Original CRISPR GGCCCCGGGAGCCACGGGGA AGG (reversed) Intergenic
No off target data available for this crispr