ID: 1049229952

View in Genome Browser
Species Human (GRCh38)
Location 8:141476816-141476838
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049229945_1049229952 0 Left 1049229945 8:141476793-141476815 CCCGTGGCTCCCGGGGCCCTCAG No data
Right 1049229952 8:141476816-141476838 GCATTCCAGTCCTGCCACCCTGG No data
1049229949_1049229952 -10 Left 1049229949 8:141476803-141476825 CCGGGGCCCTCAGGCATTCCAGT No data
Right 1049229952 8:141476816-141476838 GCATTCCAGTCCTGCCACCCTGG No data
1049229937_1049229952 24 Left 1049229937 8:141476769-141476791 CCTGCAGTAGCCTGGACGACCTT No data
Right 1049229952 8:141476816-141476838 GCATTCCAGTCCTGCCACCCTGG No data
1049229948_1049229952 -9 Left 1049229948 8:141476802-141476824 CCCGGGGCCCTCAGGCATTCCAG No data
Right 1049229952 8:141476816-141476838 GCATTCCAGTCCTGCCACCCTGG No data
1049229946_1049229952 -1 Left 1049229946 8:141476794-141476816 CCGTGGCTCCCGGGGCCCTCAGG No data
Right 1049229952 8:141476816-141476838 GCATTCCAGTCCTGCCACCCTGG No data
1049229939_1049229952 14 Left 1049229939 8:141476779-141476801 CCTGGACGACCTTCCCCGTGGCT No data
Right 1049229952 8:141476816-141476838 GCATTCCAGTCCTGCCACCCTGG No data
1049229944_1049229952 1 Left 1049229944 8:141476792-141476814 CCCCGTGGCTCCCGGGGCCCTCA No data
Right 1049229952 8:141476816-141476838 GCATTCCAGTCCTGCCACCCTGG No data
1049229936_1049229952 25 Left 1049229936 8:141476768-141476790 CCCTGCAGTAGCCTGGACGACCT No data
Right 1049229952 8:141476816-141476838 GCATTCCAGTCCTGCCACCCTGG No data
1049229943_1049229952 5 Left 1049229943 8:141476788-141476810 CCTTCCCCGTGGCTCCCGGGGCC No data
Right 1049229952 8:141476816-141476838 GCATTCCAGTCCTGCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049229952 Original CRISPR GCATTCCAGTCCTGCCACCC TGG Intergenic
No off target data available for this crispr