ID: 1049230675

View in Genome Browser
Species Human (GRCh38)
Location 8:141479644-141479666
Sequence GTGTTTAAGAAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049230663_1049230675 27 Left 1049230663 8:141479594-141479616 CCCTCACTGCCGGCTATGAGCAG No data
Right 1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG No data
1049230666_1049230675 18 Left 1049230666 8:141479603-141479625 CCGGCTATGAGCAGGCTGTGCCG No data
Right 1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG No data
1049230664_1049230675 26 Left 1049230664 8:141479595-141479617 CCTCACTGCCGGCTATGAGCAGG No data
Right 1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG No data
1049230670_1049230675 -2 Left 1049230670 8:141479623-141479645 CCGGAGTGGCAACGAGGAGATGT No data
Right 1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049230675 Original CRISPR GTGTTTAAGAAGGAGGAGGA GGG Intergenic
No off target data available for this crispr