ID: 1049236748

View in Genome Browser
Species Human (GRCh38)
Location 8:141515933-141515955
Sequence CAGTGTGAGGAGAGAGACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 484}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049236748_1049236757 24 Left 1049236748 8:141515933-141515955 CCATCGTCTCTCTCCTCACACTG 0: 1
1: 0
2: 0
3: 25
4: 484
Right 1049236757 8:141515980-141516002 CCCTGAGAAGCTGAAGGCATTGG No data
1049236748_1049236759 30 Left 1049236748 8:141515933-141515955 CCATCGTCTCTCTCCTCACACTG 0: 1
1: 0
2: 0
3: 25
4: 484
Right 1049236759 8:141515986-141516008 GAAGCTGAAGGCATTGGAAGAGG No data
1049236748_1049236754 18 Left 1049236748 8:141515933-141515955 CCATCGTCTCTCTCCTCACACTG 0: 1
1: 0
2: 0
3: 25
4: 484
Right 1049236754 8:141515974-141515996 CTCCTTCCCTGAGAAGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049236748 Original CRISPR CAGTGTGAGGAGAGAGACGA TGG (reversed) Intronic
900284450 1:1892246-1892268 CAGGGTGTGGAGAGAGTAGAAGG - Intergenic
900324885 1:2103859-2103881 CAGTGGGAGGAGAGGGGTGAAGG + Intronic
901001198 1:6149568-6149590 AAGGGTGAGGAGATAGAAGATGG + Intronic
901946356 1:12707118-12707140 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
902051966 1:13570892-13570914 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
903459461 1:23510240-23510262 CAGGCTAAGGAGAGAGAAGAAGG - Intronic
904330533 1:29755454-29755476 CAGTGTCTGGGGAGAGAAGATGG + Intergenic
904416144 1:30362140-30362162 CAGTGTCTGGGGAGAGAAGATGG - Intergenic
904960250 1:34327083-34327105 TAGTGAGAAGAGAGAGATGATGG - Intergenic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905863012 1:41362832-41362854 CAGGGTGAGGAGTGTGACCATGG + Intronic
907946886 1:59143747-59143769 CAGGGTGATGAGAGATATGATGG + Intergenic
908766096 1:67555728-67555750 CAGCGTGAGGAGGGAGGGGAGGG + Intergenic
909342858 1:74551078-74551100 CAGAGTGAGAAGGGAGAGGAGGG - Intergenic
909532928 1:76700848-76700870 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
910042417 1:82868662-82868684 GAGAGTGAGGAGAGTGAGGAAGG + Intergenic
910203432 1:84723797-84723819 CAGTTTGAGGAGAGAGCCACTGG - Intergenic
910640275 1:89453496-89453518 TAGAGTGAGGAAAGAGACCAAGG + Intergenic
910808094 1:91208507-91208529 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
910852974 1:91666627-91666649 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
911238983 1:95444204-95444226 CAGTGGATGGAGAGAGACAATGG - Intergenic
911626349 1:100129300-100129322 CAATTTGAGGACAGAGACCATGG - Intronic
912164861 1:107031034-107031056 TGGGGTGAGGAGAGAGACTAAGG - Intergenic
912816005 1:112829222-112829244 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
912980431 1:114366134-114366156 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916352947 1:163872776-163872798 GAGTTTGGGGAAAGAGACGAAGG + Intergenic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
919661844 1:200255154-200255176 CCGTGTGGGTTGAGAGACGAGGG - Intergenic
919823038 1:201484793-201484815 CAGAGAGAGGAGAGAGATAAGGG + Intronic
920376506 1:205511334-205511356 CAGAGTGGCGACAGAGACGATGG + Intronic
920376701 1:205512592-205512614 GAGTGTGAGGAGGGAGAGGCGGG + Intronic
921074624 1:211690402-211690424 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
921980347 1:221250468-221250490 GAGTGTGAGAAGTGAGACAATGG - Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
923147778 1:231209963-231209985 GTGTCTGAGGAGAGAGACCAAGG - Intronic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923863635 1:237916985-237917007 AAGAGTGAGGAGAGACAGGAGGG - Intergenic
924198783 1:241639506-241639528 CACTTTGAGGAAAGAGACGAGGG - Intronic
924735247 1:246749803-246749825 CAGTCTGAGGAGAGCTAGGAAGG + Intronic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1064666928 10:17662957-17662979 CAAAGTGAAGAGAGAGAGGAGGG - Intronic
1065726145 10:28669385-28669407 GAGTGGGAGGAGGGAGACGGGGG - Intergenic
1065930989 10:30479013-30479035 CAGTGTGAGGAGAGTCAGGAGGG - Intergenic
1066585548 10:36930425-36930447 CAGTTTGTGTAGAGAGACAATGG - Intergenic
1067785408 10:49242133-49242155 CAGTGTCAGAACTGAGACGAAGG - Intergenic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1068352724 10:55869596-55869618 CAGTTTGAGGTGAGAGAGGGAGG - Intergenic
1068671813 10:59730648-59730670 CAGTCTGAGGAGAGTCATGAGGG + Intronic
1068675816 10:59768215-59768237 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1069622674 10:69847493-69847515 CAGAGTAGGGAGAGAGATGAGGG - Intronic
1070410311 10:76133544-76133566 CAATGTGTGGAGAGCGAGGAGGG + Intronic
1070987878 10:80703650-80703672 CAGTGTGGTGAGAGACAGGATGG + Intergenic
1072334787 10:94388416-94388438 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1074322906 10:112420211-112420233 CAGAGTTGGGAGAGAGAGGAAGG - Intronic
1074679833 10:115894002-115894024 CAGGATGAGGAAAGAGACAAGGG + Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1075663521 10:124214814-124214836 CAGTCTGCAGAGAGAGACCATGG + Intergenic
1076411107 10:130251624-130251646 GGGGGTGAGGAGAGAGAGGAAGG - Intergenic
1076462903 10:130658556-130658578 CAGTGTGAGGAGAGAGGAAGAGG + Intergenic
1077246334 11:1541026-1541048 CAGTGTGAAGAGACACAGGAAGG + Intergenic
1077317438 11:1925687-1925709 CAGAGTGAGGGGAGAGAAGGCGG + Intronic
1077332159 11:1988505-1988527 GAGGGTGAGGAGGGAGAGGAGGG + Intergenic
1078060806 11:8041671-8041693 CAGAGTGAGGAGAAAAACTAGGG - Intronic
1078450307 11:11436071-11436093 CTGCGTGAGCAGAGAGGCGAGGG + Intronic
1079121138 11:17686037-17686059 CAGTAGGAGGAGAGAGACCGGGG + Intergenic
1079794859 11:24788505-24788527 CAGTTTGAGGACAAAGAAGAAGG - Intronic
1080017430 11:27522181-27522203 AAGTTTGAGGAGAGAGCAGAAGG - Intergenic
1080102556 11:28476207-28476229 CAGTGTGAAGAGGGGGACAATGG - Intergenic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1082173147 11:49030556-49030578 AAGTTTCAGGAGAGAGACGGAGG + Intronic
1082914959 11:58423151-58423173 CAGAGTGAGGAGGTAGATGAAGG + Exonic
1083089876 11:60189000-60189022 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1083096984 11:60260989-60261011 AGGTGAGAAGAGAGAGACGAGGG - Intergenic
1083669658 11:64292712-64292734 CCGGGTGAGGAAAGAGAGGAGGG - Exonic
1083740633 11:64709493-64709515 CAGAGTGGGGAGAGAAAAGAAGG + Intronic
1083801038 11:65046426-65046448 CCGGGTGAGGAGGGAGACAAGGG - Exonic
1083874799 11:65516319-65516341 CAGAGAGAGGAGAGAGAGAAAGG + Intergenic
1084051475 11:66602986-66603008 CAGGGTGAGGAGAGAACAGAAGG - Intronic
1084938990 11:72602318-72602340 CAGTGTGGGGAGAGACAGGGTGG - Intronic
1085065077 11:73487886-73487908 CAGGGTTAGGAGAGAGGTGAGGG - Intronic
1085902587 11:80719455-80719477 CAGTTTGTGTAGAGAGACAATGG + Intergenic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1086059140 11:82682440-82682462 GAGTGAGAGGAGAGAGAGAAAGG + Intergenic
1086311019 11:85536611-85536633 AAGTGTGAAGAGAGAGGCGCAGG + Intronic
1086692620 11:89805495-89805517 AAGTTTCAGGAGAGAGACGGAGG - Intronic
1086713180 11:90034165-90034187 AAGTTTCAGGAGAGAGACGGAGG + Intronic
1086745012 11:90414190-90414212 CAGGGTGAGGGGAGAGGGGAGGG - Intergenic
1086973476 11:93107689-93107711 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1086987553 11:93266827-93266849 CAGTCTGAGGAGAGCTAGGAAGG - Intergenic
1087456819 11:98396880-98396902 CAGTTTGAGGAGAGTCAGGAGGG + Intergenic
1087894792 11:103575606-103575628 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088637222 11:111834252-111834274 TAGTGTGAGAAGAGACACAAGGG + Intronic
1089148182 11:116345564-116345586 CAGTAGGATGAGAGAGAAGAGGG - Intergenic
1089334340 11:117712847-117712869 CAGGGTGGGGAGAGAGGCGGGGG - Intronic
1089928859 11:122288140-122288162 CAGTGAGAGGAGGGGGACGTAGG + Intergenic
1090876846 11:130797875-130797897 AAGTATGAGGAGAGACAGGAGGG + Intergenic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1091105149 11:132911658-132911680 GAGTGTGAGGACAGAGGAGAAGG - Intronic
1202815140 11_KI270721v1_random:43681-43703 GAGGGTGAGGAGGGAGAGGAGGG + Intergenic
1091814531 12:3426525-3426547 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1093226335 12:16488352-16488374 CAGAGAGGGGAGAGAGATGAGGG - Intronic
1093582972 12:20805418-20805440 AATTTTGAGGAGAGAGATGAAGG + Intergenic
1093750811 12:22797775-22797797 AAGTGTGAGGAGAGAAAAAAAGG + Intergenic
1096201065 12:49683459-49683481 CATTGTGAGGATAGAGGTGAGGG - Intronic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1097013480 12:55969334-55969356 CAGTGGGAGGGGAAAGATGATGG + Intronic
1097090383 12:56499982-56500004 AAGAGTGAGGAGAGACAGGAGGG + Intergenic
1097899518 12:64858840-64858862 CAGTGTGGGGAGTGCGTCGAGGG + Intronic
1098248377 12:68543781-68543803 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1098663931 12:73136138-73136160 CACTTTGAGGATAGAGACCAGGG + Intergenic
1101533011 12:105591757-105591779 AAGTGTGAAGAGAGAGCTGAAGG - Intergenic
1101783813 12:107864324-107864346 AAGTGTGAAGAGAGAGGCGCGGG + Intergenic
1101975245 12:109352352-109352374 GAGTGGGAGGTGAGAGATGAGGG - Intronic
1102573956 12:113844308-113844330 CACTGTGAGGACAGAGCCAACGG + Intronic
1102606369 12:114070837-114070859 CAGTCTGAGGAGAGCAAGGAGGG - Intergenic
1102810487 12:115819955-115819977 AAGTGTGAGGAGAGAGAACATGG + Intergenic
1102901981 12:116646112-116646134 CACCGTGAGGACAGAGAGGAGGG + Intergenic
1103561353 12:121794703-121794725 CAGGGTGAGGAGTAAGAGGAGGG - Intronic
1103966194 12:124641463-124641485 GAGTGGGAGGAGAGAAACCAAGG - Intergenic
1104337237 12:127910812-127910834 AAGTGTGAGGTAAGAGAGGAAGG - Intergenic
1104483701 12:129130695-129130717 CAGTGAGAGGAGAGACAGGGTGG + Intronic
1105237198 13:18568085-18568107 AAGTGTGAAGAGAGAGGCGCGGG - Intergenic
1106138460 13:26991745-26991767 CAGTGAGAGGAAAGAAACCAGGG + Intergenic
1106256819 13:28029888-28029910 CAGTGTGAGGAAAGTCACTATGG + Intronic
1106326496 13:28695383-28695405 CAGTGTGAGAAATGAGATGAGGG - Intergenic
1106481448 13:30140195-30140217 AAGTGTGTGGAGGGAGAGGAAGG - Intergenic
1106899183 13:34336880-34336902 CAGTGTCTGGAGAGAAAAGAAGG + Intergenic
1107115926 13:36745475-36745497 CACTGTGAGGAGTGAGCAGAGGG - Intergenic
1108272597 13:48776537-48776559 CATTGTGAGGGGAGTGACAAGGG + Intergenic
1109909515 13:68891066-68891088 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1110604411 13:77415068-77415090 AAGTGTCAGGAGAGAAAGGAAGG + Intergenic
1110951229 13:81494147-81494169 CAGAATGAGGAGAGAGACAAAGG + Intergenic
1111097926 13:83538897-83538919 AAGAGTGAGGAGAGTGGCGAAGG - Intergenic
1111915048 13:94351939-94351961 CAAGGAGAGGAGAGAGAAGAAGG + Intronic
1112030787 13:95454527-95454549 CAGGGTGGGGAGAGAGGGGAGGG - Intronic
1112092848 13:96100558-96100580 CAGTAGTAGGAGAGAGCCGAAGG + Intronic
1114236106 14:20825016-20825038 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1116402160 14:44521243-44521265 CAGTGTGGGAAGAGTGACTAGGG + Intergenic
1118325080 14:64775013-64775035 CTGTGTGAGGAGTGAGGCCAGGG - Intronic
1118347907 14:64953041-64953063 CAGACTGTGGAGAGAGAGGAGGG + Intronic
1119330829 14:73792308-73792330 AAGGGTAAGGAGAGAGAAGAGGG + Intergenic
1119653361 14:76399150-76399172 CTGTGTGATGAGGGAGACGGGGG + Intronic
1119931722 14:78553998-78554020 GAGTGTGTGGAGGGAGATGAAGG + Intronic
1120540323 14:85742791-85742813 GAGTGTGAGAAGAGAGAAAATGG - Intergenic
1121939827 14:98059478-98059500 CTGTGAGAGGAGAGAGAGAAAGG + Intergenic
1122160360 14:99779869-99779891 CAGTGAGAGGAAGGAGACGGGGG + Intronic
1122382802 14:101321679-101321701 CAGTCTGAGGAGAGCTAGGAAGG - Intergenic
1122438010 14:101712318-101712340 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122438397 14:101713710-101713732 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122660683 14:103293009-103293031 CAGTCTGAGGACAGAGATGAGGG + Intergenic
1122723873 14:103737723-103737745 AAGTGTGAGGAGATGGAGGAAGG - Exonic
1122993771 14:105251480-105251502 GAGTGGGAGGAGAGAGACAAGGG - Intronic
1123180690 14:106467398-106467420 CAGTGTGAGGAAGGAGATGGCGG + Intergenic
1202946209 14_KI270726v1_random:29260-29282 CAGTGTGAGGAAGGAGATGGCGG - Intergenic
1125690305 15:41590905-41590927 CAGTCTGAGGAGAGCCAGGAGGG - Intergenic
1125863515 15:43020358-43020380 CAGTCTGATGGGAGAGATGAAGG - Intronic
1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG + Intergenic
1127550196 15:60029952-60029974 AAGTGTAAGGAGAGTGACCAGGG - Intronic
1128683134 15:69665908-69665930 CAGTGGGAGGAGAGAGGGGCTGG + Intergenic
1128830312 15:70762969-70762991 CCGGGAGAGGAGAGCGACGAGGG + Intronic
1129700950 15:77768497-77768519 CATTGTGAGGAGAGCCATGAAGG + Intronic
1130766651 15:86877850-86877872 GAATGTGAGAAGAGAGAAGAAGG - Intronic
1130978884 15:88799063-88799085 CCCTGTGAGGAGAGACATGAAGG + Intergenic
1131316055 15:91338673-91338695 GAGAGTGAGGAGAGAGAGGGAGG + Intergenic
1131830813 15:96353677-96353699 CAGTGCGAAGAGAGAGACCCAGG + Intergenic
1132465046 16:73530-73552 CAGTGTCAGGAGAGAAATGCTGG - Intronic
1133042647 16:3068706-3068728 CTGTGTGAGGAGTGAGGCCATGG - Intronic
1133313991 16:4870777-4870799 CAGAGTGAGGGGAGAGGCGGTGG + Intronic
1133745567 16:8684066-8684088 CACAGTGAGGAGAGTGCCGAAGG + Intronic
1138371603 16:56531286-56531308 CAGGGTGATGTGAGAGACTAGGG - Intergenic
1138598378 16:58041418-58041440 CAGTGTGGGGAGATCGAGGAGGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141152720 16:81575343-81575365 TGGTGTGGGGAGAGAGAGGAAGG - Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1144013147 17:11169517-11169539 CGGTGTGTGGAGAGAGGGGAAGG - Intergenic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1144583748 17:16475314-16475336 GTGTGTGTGGAGAGAGAGGAAGG + Intronic
1144591527 17:16528300-16528322 CACTGGGAGGAGAGAGGCTATGG + Intergenic
1144951030 17:18993537-18993559 CATAGTGAGGAGAGAGAATATGG - Intronic
1145413876 17:22696098-22696120 AAGTATGGGGAGAGAGAGGATGG - Intergenic
1146711096 17:35042080-35042102 CAGAGAGAGGAGAGAGACCTTGG - Intronic
1146764143 17:35504179-35504201 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1146970573 17:37068426-37068448 CCGTGTGAGGACAGATAGGAGGG + Intergenic
1147179360 17:38674661-38674683 CCGCGTGAGGAGAGCGAAGAGGG - Exonic
1147562387 17:41517053-41517075 CAGGAAGAGGAGAGAGACGGGGG + Intronic
1147810324 17:43164376-43164398 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1148869695 17:50649602-50649624 GAGAGAGAGGAGAGAGATGAGGG + Intronic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1149932573 17:60770371-60770393 CACTGGGATGAGAGAGGCGATGG - Intronic
1150843602 17:68632826-68632848 CAAAGTGAGGAGAGAGACTGTGG + Intergenic
1150895654 17:69207751-69207773 CAGTGGGTGGAGAGAGAGCAGGG + Intronic
1152454930 17:80409319-80409341 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1153830371 18:8917220-8917242 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1154014151 18:10601575-10601597 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1154317449 18:13316038-13316060 CGGTGAGAGGAGAGAGATGGGGG + Intronic
1155198909 18:23500793-23500815 CAGTCTGAGGAGTGTGAAGAAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157464650 18:47932430-47932452 ATGTGTGAGGACAGAGACGGTGG - Intergenic
1157753202 18:50195895-50195917 AAGTCTGTGGAGGGAGACGAGGG + Intergenic
1158371297 18:56808065-56808087 CAATGTGTGCAGAGAGACTAGGG + Intronic
1159308969 18:66683207-66683229 CAGTGTGAGCACAGAAACTAAGG + Intergenic
1161088895 19:2350045-2350067 GAGTGTGTGGAGAGAGAGAACGG - Intronic
1161088905 19:2350270-2350292 GAGTGTGTGGAGAGAGAGAACGG - Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161625608 19:5324834-5324856 CAGTGTGAGGATGGGGATGATGG - Intronic
1161706582 19:5825004-5825026 CGGTGGGAGGAGAGAGAGGCTGG + Intronic
1161990598 19:7681969-7681991 AGGTGGGAGGAGAGACACGAGGG - Intronic
1162267829 19:9590272-9590294 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
1162281882 19:9705356-9705378 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1162292736 19:9792007-9792029 CTCCGTGAGGGGAGAGACGAGGG - Intronic
1162409882 19:10499347-10499369 CAGTGTCAGGAGAAGGACCAGGG - Intronic
1163026037 19:14512918-14512940 CAGTGTGAGGAGTGGGACGGTGG - Intergenic
1163314013 19:16530679-16530701 CGGTGGGAGGAGAGAGAGGCCGG + Intronic
1163991832 19:21006199-21006221 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1164084479 19:21888796-21888818 AAGAGTGAGGAGAGACAGGAGGG + Intergenic
1164121585 19:22270033-22270055 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1164130739 19:22358964-22358986 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1164536037 19:29087287-29087309 AGGTGGGAGGAGAGAGACCAGGG + Intergenic
1164786568 19:30935784-30935806 CAGTGTGAGGAGAAAGACTGTGG - Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165384790 19:35503969-35503991 CAGAGTGAGGAGGGAGCAGAGGG - Intronic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1166065054 19:40352996-40353018 CAGGGTGTGGAGTGAGACAATGG - Intronic
1166357693 19:42236745-42236767 CACTGTGAGAAGAGTGAGGAGGG + Intronic
1166773434 19:45298117-45298139 CAGTGTGAGGAGGGAGGTGAGGG - Intronic
1167433044 19:49464216-49464238 CAGTGTGTGGAGCGAGAGGCTGG + Exonic
1167792796 19:51691549-51691571 CGGGGAGAGGAGAGAGGCGATGG + Intergenic
925642988 2:6005318-6005340 CAGTGGGATGGGAGAGACGGTGG - Intergenic
925826145 2:7850177-7850199 CAGGTAGAGGAGAAAGACGAGGG - Intergenic
925931262 2:8709815-8709837 CAGAGAGAGGAAAGAGACGCAGG + Intergenic
926181004 2:10642871-10642893 CAGTGTGAGGAGTGCTACCAGGG - Intronic
926491474 2:13530134-13530156 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
926630448 2:15130794-15130816 CAGTGTGGGAAGAGAGAGGGTGG - Intergenic
927114248 2:19885909-19885931 GAGAGTGAGGGGAGAGAGGAAGG - Intergenic
927550952 2:23998831-23998853 GAGGCTGAGGAGGGAGACGAAGG - Intronic
928453239 2:31397586-31397608 CACTGTGGGGAGGGAGACCAAGG - Intronic
928877739 2:36060475-36060497 CAGTGAGAGGAGATAAACCAAGG + Intergenic
930681390 2:54260299-54260321 GAGTCTGAGGACAGAGAAGAAGG + Intronic
930793271 2:55357384-55357406 GAGAGAGAGGAGAGAGAGGAGGG - Intronic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932612495 2:73210215-73210237 CAGTGAGAGGAGAAAGTCAAGGG - Intronic
932639016 2:73423284-73423306 GAGAGGGAGGAGAGAGATGATGG - Intronic
932697585 2:73969614-73969636 AAGTCTGAGGAGAGAGTCCAGGG - Intergenic
932770187 2:74496846-74496868 CAGTGTGAGGGGAGAGGAGGGGG - Intergenic
933389486 2:81652178-81652200 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
935048394 2:99502485-99502507 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
935958721 2:108403000-108403022 CAGTCTGAGGAGAGCTAGGAAGG - Intergenic
938512579 2:131966428-131966450 AAGTGTGAAGAGAGAGGCGCGGG + Intergenic
938663011 2:133506519-133506541 CAGTGTGAGGAGAATGAAGTGGG + Intronic
938703145 2:133897329-133897351 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
939383381 2:141465305-141465327 GAGTGTGAGGGGAGAGAAAAAGG + Intronic
940453794 2:153872106-153872128 AAGTGTGAAGAGAGAGGCGCGGG + Exonic
942483910 2:176419397-176419419 CAGTGTGGGAAGAGAGAAGGGGG - Intergenic
942989786 2:182186225-182186247 CAGTGTGGGGAGGGAGAGAAAGG - Intronic
943408071 2:187513942-187513964 CAGTCTGAGGAGAGTCAGGAAGG - Intronic
944978108 2:205080978-205081000 CACAGTGATGAGAGAGAGGAGGG - Intronic
945050530 2:205819983-205820005 CAGAGAGAAGAGAGAGAGGAGGG - Intergenic
945289724 2:208115356-208115378 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947587030 2:231362625-231362647 CAGTGTGAGGAAGAAGAGGATGG + Intronic
948370577 2:237487048-237487070 CAGTTTGGGGAGAAAGACGGCGG - Intronic
948620637 2:239232354-239232376 CAGTTTGAGGACAGAGGAGAAGG - Intronic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1168796732 20:615134-615156 CCGTCTGTGGAGAGAGACCAAGG + Intergenic
1168822725 20:786544-786566 CAGTCTGAGGAGAGCCAGGAAGG + Intergenic
1169091056 20:2861723-2861745 CTGTGTGTGGAGAGAGGGGAGGG + Intronic
1169710994 20:8563387-8563409 AAGTGGGAGGAGAGAGATGATGG - Intronic
1170098744 20:12675455-12675477 CAGTGGGAGGAGAGACAAGCAGG + Intergenic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1172221272 20:33276686-33276708 CAGAGAGAGGAGAGAGACAGTGG + Intronic
1174905243 20:54543601-54543623 GAGAGAGAGGAGAGAGAGGAGGG + Intronic
1175240797 20:57547100-57547122 CCATGTGAAAAGAGAGACGATGG - Intergenic
1175366867 20:58461674-58461696 GGGAGTGAGGAGAGAGAGGAGGG - Intronic
1175513892 20:59555753-59555775 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1175624365 20:60478167-60478189 CTGTGTCAGGAGAGAGAGAAAGG - Intergenic
1176781183 21:13196367-13196389 AAGTGTGAAGAGAGAGGCGCGGG - Intergenic
1177741364 21:25158064-25158086 AAGTGTGGGGAGAGAGAAAAAGG + Intergenic
1179522212 21:41953212-41953234 GAGAGTTAGGAGAGAGACGGGGG - Intronic
1179670902 21:42946931-42946953 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1179712674 21:43272379-43272401 CAGGGCCAGGAGAGAGACCAGGG + Intergenic
1180257596 21:46643177-46643199 CAGTGTGAGGACAGAGCCAGGGG - Intronic
1181603309 22:23965084-23965106 CACAGTGAGGAGAGAGACCGAGG - Intergenic
1181605205 22:23976223-23976245 CACAGTGAGGAGAGAGACCGAGG + Intronic
1182023801 22:27101701-27101723 CAGTGTGATGGGAGAGGAGATGG + Intergenic
1183692449 22:39398383-39398405 GAGTTGGAGGAGAGAGATGAAGG - Intergenic
1183777508 22:39976299-39976321 GAGTGAGAAGAGAGAGACGGAGG - Intergenic
1183831933 22:40422849-40422871 CTGTGTGAGGAGAGAGCCTGGGG + Intronic
1185134279 22:49060268-49060290 GAGTGAGAGGAGAGAAACGGAGG - Intergenic
949243958 3:1903423-1903445 TAGTGTGAGGAGAGACAGGGAGG + Intergenic
949609906 3:5693349-5693371 CAGTCTGAGGAGAGCTAGGAAGG + Intergenic
949610961 3:5702931-5702953 CAGTCTGAGGAGAGTCACAAGGG + Intergenic
950227755 3:11249834-11249856 CAGTCTGAGGAGAGCCAGGAAGG + Intronic
950846158 3:16017853-16017875 CAGTTTGAGGAGAGCCAGGAGGG + Intergenic
951248570 3:20368156-20368178 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
951502961 3:23410961-23410983 TAGTTTGAGGAGGGAGAGGAGGG - Intronic
954604723 3:51900530-51900552 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
954879904 3:53827270-53827292 CAGTAGGAAGAGAGAGAGGAGGG - Intronic
954959821 3:54554297-54554319 CAGTATGAGGAGAGAAACAATGG - Intronic
955035639 3:55264567-55264589 GAGGATGAGGAGAGAGAAGAAGG + Intergenic
955424018 3:58768783-58768805 CATTGTAAGAAGAGAGACTACGG - Intronic
955558352 3:60162101-60162123 CTCTGTGAGGAGACAGAGGAAGG + Intronic
956681543 3:71785671-71785693 CACCGTGAGGAGAGAGCCGGTGG - Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
957999938 3:87737748-87737770 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
959630912 3:108506335-108506357 CAGGTTGAGGAGAGAGAATATGG + Intronic
960022153 3:112966910-112966932 CAGTTTGAGTAGATAGACGTGGG - Intronic
960389790 3:117063678-117063700 CAGTGTTAGGAGTGAGATCAGGG - Intronic
960720372 3:120619286-120619308 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
961903766 3:130241367-130241389 AAGTTTGAGGAGAGAGGTGAGGG - Intergenic
962097360 3:132306220-132306242 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
962277050 3:134023441-134023463 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
963632449 3:147750223-147750245 CAGTGTCAGGAGAGACGCTATGG - Intergenic
964933033 3:162048700-162048722 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
966420836 3:179732814-179732836 CAGTGGGGGAAGAGAGACAAGGG - Intronic
966924524 3:184635774-184635796 CAGCGTGGGGAGAGAGAGGCAGG + Intronic
967674032 3:192274568-192274590 AAGAGAGAGGAGAGAGAAGAGGG + Intronic
967856009 3:194118080-194118102 CAGTCTGAGAAGGGAGATGAGGG - Intergenic
968339216 3:197941158-197941180 GAGAGAGAGGAGAGAGAGGAAGG - Intronic
968426221 4:525145-525167 CAGGATGAGGAGAGAGAAAAGGG - Intronic
968578150 4:1377439-1377461 CAGTGTGAGGAGGGAGGGGCTGG + Intronic
968957440 4:3726456-3726478 GAGGGAGAGGAGAGAGAGGAAGG + Intergenic
969122195 4:4918892-4918914 CTCTGTGAGCAGAGAGACGGGGG + Intergenic
969456623 4:7303877-7303899 GAGTGTGGGGAGAGAAAGGATGG + Intronic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970858562 4:20676104-20676126 GAGTGAGAGGAGAAAGAGGAGGG + Intergenic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
972784969 4:42318309-42318331 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
973072590 4:45883174-45883196 CAGTATGAGGAGATAGCCTATGG + Intergenic
974074296 4:57154834-57154856 CAGGGAGAGGAAAGAGAAGAGGG - Intergenic
975205632 4:71641802-71641824 CAGTCTGAGGAGAGTCAAGAGGG - Intergenic
977043586 4:92042582-92042604 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977972361 4:103227261-103227283 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
979546653 4:121948025-121948047 GAGTGTGAAGAGAGAAACAAAGG - Intronic
980438811 4:132814914-132814936 CAGTCTGAGGAGAGTCAGGATGG + Intergenic
980901017 4:138905267-138905289 AAGTGTGGGGAGAGAGGGGAGGG + Intergenic
981629109 4:146797638-146797660 CAGGGTGAGGTGGGAGAGGAAGG - Intronic
982617351 4:157656063-157656085 CAGTAAGAGGAAAGAGATGAAGG + Intergenic
983188518 4:164728828-164728850 CAGTGGGAGGAGTGAGGCAATGG - Intergenic
983708420 4:170686649-170686671 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
983897953 4:173102063-173102085 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
985171437 4:187154189-187154211 AAGTGTGAGGAGAGTGAAGGAGG + Intergenic
985259188 4:188099145-188099167 CCGTGTGGGGAGAGAGAACATGG - Exonic
986372817 5:7097831-7097853 CAATTGGAGGAGAGAGAAGAGGG + Intergenic
986424249 5:7614605-7614627 CAGGGTGAGAAGAGTGACTATGG - Intronic
986891980 5:12320384-12320406 CAGTGTGAGGAGGAAGTGGATGG + Intergenic
987923664 5:24314301-24314323 AAGTGTGAAGAGAGAGGCGCGGG + Intergenic
987930556 5:24395004-24395026 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
988733434 5:33996396-33996418 CAGCCAGAGGTGAGAGACGAGGG - Intronic
989096060 5:37782259-37782281 CAGTATGAGGAGAGTCAGGAGGG + Intergenic
989613547 5:43317506-43317528 CAGTATGAGGAGAGCCAGGAGGG + Intergenic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
992602426 5:78415963-78415985 CAGTGTTAGGAGGTAGAAGATGG + Intronic
992963677 5:81980441-81980463 AAGTGTAGTGAGAGAGACGAAGG - Intronic
993068895 5:83133940-83133962 CAGTGTGAAGAGAGAGGCGCTGG + Intronic
993108579 5:83627834-83627856 GAGTGAGAGGAGAGAGAACAGGG - Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
994714717 5:103307415-103307437 CAGTGGGAGGACAGAGGAGAAGG - Intergenic
995280293 5:110327455-110327477 CAGTGTGAGGTGATAGCCTATGG + Intronic
995867408 5:116706532-116706554 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
996296600 5:121925031-121925053 AAGTTTGAAGAGAGATACGAAGG + Intergenic
997361046 5:133295120-133295142 AAGTCTGAGGAGGGAGAAGAAGG - Intronic
997398374 5:133582385-133582407 CAGTGAGAGCTGAGAGAGGAGGG + Intronic
998179431 5:139926080-139926102 CAGGGTGTGGAGAGAGCCTAGGG + Intronic
999642904 5:153689758-153689780 CAATGTGAGTAGGGAGAGGATGG - Intronic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
1000236810 5:159369685-159369707 CAGTCTGAGGAGAGTCAGGAAGG - Intergenic
1000821937 5:165995510-165995532 CTGTGTGAAGACAGAGACGGAGG + Intergenic
1001247091 5:170112937-170112959 GAGTTTGAGGAGAGAGCGGAGGG + Intergenic
1001566493 5:172702836-172702858 CAGTGTGCTGAGATAGACAAAGG - Intergenic
1001923906 5:175622322-175622344 GAGTTTGAGGAGGGAGAAGAGGG - Intergenic
1002567449 5:180119804-180119826 CAGTGAGAGGAGAAAGCCCAGGG - Intronic
1002613261 5:180435312-180435334 GAGTGGGAGGACAGAAACGAAGG + Intergenic
1002999132 6:2314572-2314594 CAGTCTGAGGAGAGTCAGGAAGG + Intergenic
1003049375 6:2765905-2765927 GAGGGTGAGGAGGGCGACGACGG + Exonic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1004606568 6:17200601-17200623 AAGTGTGAAGAGAGAGACGCGGG + Intergenic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1005088094 6:22027514-22027536 CAGTGTGGGGAGAGAGAATAGGG + Intergenic
1005276411 6:24223975-24223997 CAGTGTTAAGAGAAAGACCAAGG - Intronic
1005461922 6:26077563-26077585 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1006325793 6:33352865-33352887 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
1007167468 6:39839025-39839047 CTGTGGGAGGAGAGAGAGGGGGG - Intronic
1008123454 6:47643992-47644014 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1012472887 6:99590776-99590798 CAGTGGGAGGAAGGCGACGAGGG - Intergenic
1012858763 6:104533843-104533865 GAGAGAGAGGAGAGAGAAGAGGG - Intergenic
1013290941 6:108718164-108718186 CAGTGTGAGAAGCCAGAGGAAGG + Intergenic
1013356768 6:109352081-109352103 CAATGTGAGGTGAGAGAAGAAGG - Intergenic
1013731684 6:113175653-113175675 CAATGTGAGGTCAGAGAGGATGG + Intergenic
1017503526 6:155046892-155046914 CAGTGTGAGATGAGAGATGCAGG + Intronic
1017588396 6:155951856-155951878 CTGTGAGAGGACAGAGATGAAGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018465271 6:164038242-164038264 CAGTGGGAGGACAGAGATGGGGG + Intergenic
1018943869 6:168331311-168331333 CAGTGTGAGGAGAGATGAAACGG - Intergenic
1018982777 6:168613350-168613372 CAGTGTGAGGACAGAGGGGGCGG + Intronic
1020043911 7:5025353-5025375 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1020146354 7:5646918-5646940 CAGTGTGAGGTGAAAGCCTAGGG + Intronic
1020655767 7:10926717-10926739 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1022705521 7:32798486-32798508 GAGAGAGAGGAGAGAGACAAAGG - Intergenic
1022957782 7:35397325-35397347 CAGGGTGAGGGGACAGAGGATGG - Intergenic
1023018195 7:35986388-35986410 AAGTGAGAGGAGGGAGAAGAAGG + Intergenic
1023049173 7:36236282-36236304 AAGTGTGAAGAGAGAGGCGCGGG + Intronic
1023659977 7:42461266-42461288 CACTGTAAGGAGGGAGATGATGG - Intergenic
1023799091 7:43817976-43817998 CAGTCTGAGGAGAGTAAGGAGGG - Intergenic
1023871378 7:44264715-44264737 CAGTGGGAGGGGAGAGGGGAGGG - Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024268703 7:47626083-47626105 CAGTGAGAGCAGAGAGAGAAAGG + Intergenic
1024812927 7:53234896-53234918 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1024921170 7:54556423-54556445 CATTGGGAGGAGGGAGATGAGGG + Intronic
1026019661 7:66697437-66697459 CACTGTGAAGGGAGAGACGTCGG - Intronic
1026880723 7:73905143-73905165 CACTGTGAAGGGAGAGACGTCGG + Intergenic
1027190496 7:75993474-75993496 CAGTGTGAGGAGAGCCAAGCAGG + Intronic
1027639030 7:80711652-80711674 AAGTGTGAGCAGAGAGCCAACGG - Intergenic
1028333967 7:89628680-89628702 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1028587056 7:92462781-92462803 CATAGTGAGGAGAGAAAGGAAGG - Intergenic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1029363606 7:100103538-100103560 GAGGGTGAGGAAAGAGAAGAGGG + Intronic
1029822051 7:103156073-103156095 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1031402550 7:121342631-121342653 CAGCGTGAGAACAGAGACGGGGG + Intergenic
1032108799 7:129057082-129057104 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
1032155173 7:129462130-129462152 TGGTTTGAGGAGAGAGAAGATGG + Intronic
1032170537 7:129581046-129581068 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1032796926 7:135285158-135285180 CAGTCTTAGATGAGAGACGATGG + Intergenic
1033530924 7:142263311-142263333 AAGTTTGAGGAGAGAGGAGAGGG + Intergenic
1034422822 7:150998308-150998330 GAGGGTGAGGAGAGAGACGGGGG - Intronic
1034929196 7:155147905-155147927 CAGGGGGAAGAGAGAGAGGAGGG - Intergenic
1035231836 7:157470031-157470053 CAGTGTGAAGAGAGTGACCTGGG - Intergenic
1036794874 8:11748594-11748616 CAGTGTGAGGTGAGAGGCCTAGG + Intronic
1036803116 8:11807882-11807904 CAGTAAGAGGAGAGAGACCTCGG + Intronic
1037061027 8:14509821-14509843 AAGTGGCAGGAGAGAGAAGAGGG + Intronic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1038089650 8:24239134-24239156 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1038392578 8:27217627-27217649 CAGCATCAGGAGAAAGACGATGG + Intergenic
1038948974 8:32392970-32392992 CAGTGTGAGGGCAGAGACAGTGG - Intronic
1041302387 8:56426365-56426387 GAGTGTGAAGGGAGAGAGGAGGG - Intergenic
1041348749 8:56928360-56928382 CAGTGTGAGGACTGACACCATGG + Intergenic
1041392361 8:57358445-57358467 CAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1041719981 8:60966852-60966874 CATTGGGTGGAGAGAGAGGAAGG + Intergenic
1043057503 8:75457879-75457901 TATTGTGAGGAGTGAGATGATGG + Intronic
1043401250 8:79886574-79886596 CATTGAGAGGAGAGAGAGGTGGG + Intergenic
1043778193 8:84297189-84297211 CAGTGGGAGGAGGGAGAGGAAGG - Intronic
1044108938 8:88247867-88247889 CACTGTGATGAGAGAGAGTAGGG - Intronic
1045498295 8:102726664-102726686 GAGTGCGGGGAGAGAGAGGAAGG + Intergenic
1046025314 8:108715273-108715295 TAGTGGGAGGAGGGAGGCGAGGG + Intronic
1047198738 8:122745569-122745591 CAATAGGAGGAGAGAGACTAGGG - Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048148183 8:131866004-131866026 GGGTGTGAGGAAAGAGAAGATGG - Intergenic
1048220028 8:132532629-132532651 CAGCATGAGGAGAGAGACACAGG - Intergenic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1049274974 8:141715748-141715770 CAGGGTGAGGAGAGAAAAAAAGG - Intergenic
1049522974 8:143104042-143104064 CAGTGTGGGGACAGAGACCAAGG + Intergenic
1050898238 9:10910940-10910962 AAGTGTGAAGAGAGAGGCGCAGG + Intergenic
1052508073 9:29380709-29380731 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1053193739 9:36098037-36098059 CAGGAGGAGGAGAGAGAAGAGGG + Intronic
1054821034 9:69520761-69520783 CAGTTTGAGGAGGGAGATAAGGG - Intronic
1055197557 9:73614940-73614962 CAATGAGACGAGAGAGATGATGG - Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1056414437 9:86362616-86362638 CAGTCTGAGGAGAGTCAGGAAGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057060990 9:92003840-92003862 CACTGTGTAGAGAGAGACCAGGG + Intergenic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1057545769 9:96019846-96019868 CAGGGTGGTGAGAGAGAGGAAGG + Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058164901 9:101608165-101608187 CAGTGTGTGTAGAGATAGGAGGG - Intronic
1058645148 9:107124996-107125018 CAGGGTGAGGAGAGAGCCCTTGG + Intergenic
1059438709 9:114290807-114290829 CAGGGGGAGCAGGGAGACGATGG + Exonic
1061164245 9:128913235-128913257 CAGAGTGAGGAGAGAGACAGCGG + Intronic
1061573605 9:131492642-131492664 AAGTCTGAGGAAAGAGACGCTGG - Intronic
1061640206 9:131947986-131948008 CAGTGGGTGGAAACAGACGAGGG + Intronic
1186576338 X:10770141-10770163 CAGTCTGAGGGAAGAGATGAGGG - Intronic
1187226837 X:17381020-17381042 CAATGTGAGGAGAGAAGGGAGGG + Intronic
1187921099 X:24202668-24202690 CAGTGTGAGGACAGAGTCCTGGG - Intronic
1189034549 X:37482484-37482506 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189833887 X:45001514-45001536 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1190270251 X:48857614-48857636 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1190771205 X:53516264-53516286 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1191639219 X:63412530-63412552 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1191917993 X:66222732-66222754 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1193189843 X:78557604-78557626 GAGTATGATGAGAGAGATGAAGG - Intergenic
1193717315 X:84948273-84948295 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1195846865 X:109238228-109238250 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1196340097 X:114585004-114585026 GAGTGGGAGGAGAGAAAGGAGGG + Intronic
1196423019 X:115541848-115541870 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1196460054 X:115920360-115920382 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1196869391 X:120098587-120098609 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1196982689 X:121232291-121232313 CAGTGTGAGGAGGGAGTGGGTGG + Intergenic
1198073855 X:133176199-133176221 CAGTGTGAGGAGCAAAACCAAGG - Intergenic
1198742457 X:139855778-139855800 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1199638339 X:149835062-149835084 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1199836917 X:151600249-151600271 CCGTGCAAAGAGAGAGACGAGGG + Intronic
1201260088 Y:12150256-12150278 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1201308891 Y:12576729-12576751 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1201592984 Y:15636104-15636126 CAGTGTGAGGCGAGAGAGTGGGG - Intergenic
1202088080 Y:21160169-21160191 CAGTTAGAGGAGAAAGACAAAGG + Intergenic