ID: 1049236875

View in Genome Browser
Species Human (GRCh38)
Location 8:141516701-141516723
Sequence CTCTGCTTGTAGAGGGGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049236875_1049236882 19 Left 1049236875 8:141516701-141516723 CCTCGACCCCTCTACAAGCAGAG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1049236882 8:141516743-141516765 AGCGGATCTTCTCCAGCCTCTGG No data
1049236875_1049236880 1 Left 1049236875 8:141516701-141516723 CCTCGACCCCTCTACAAGCAGAG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1049236880 8:141516725-141516747 AGTCCAGGCTCTTGTGTGAGCGG No data
1049236875_1049236883 20 Left 1049236875 8:141516701-141516723 CCTCGACCCCTCTACAAGCAGAG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1049236883 8:141516744-141516766 GCGGATCTTCTCCAGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049236875 Original CRISPR CTCTGCTTGTAGAGGGGTCG AGG (reversed) Intronic
900157973 1:1211172-1211194 CTCTGGCTGGAGAGGGGTCTTGG - Intergenic
900158001 1:1211258-1211280 CTCTGACTGGAGAGGGGTCTTGG - Intergenic
900521683 1:3108616-3108638 CTCTGCTTTTGGAGGGGTGGAGG + Intronic
903968011 1:27101869-27101891 CTCTGCTCATGGAGGGGTGGGGG + Intronic
904093143 1:27959078-27959100 GTATGCTTGTAGGGGGGTCTTGG - Exonic
904537493 1:31209427-31209449 CTCAGCTGGGAGAGGGGTGGAGG - Intronic
906149936 1:43581753-43581775 CTCTGCTGGGAGATGGGACGGGG - Intronic
906785975 1:48616304-48616326 CTCTGGTTGTAGAGGCCTCCTGG - Intronic
910951561 1:92653696-92653718 CTCTGCATGGAGAGGGGGAGGGG - Intronic
924807896 1:247375849-247375871 CTCTGCTTCTGGTGGGGACGCGG - Intergenic
1063417853 10:5888994-5889016 CTCTGCGAGTAGAGGGGAGGCGG + Intronic
1063961138 10:11306208-11306230 CTCTGCTTGAAGAGGTGTTCTGG + Intronic
1071214155 10:83379195-83379217 CTCTATTTGTAGAGGGTTTGAGG - Intergenic
1072613511 10:97034780-97034802 CTCTGCTTGCAGAGGGATGGGGG - Intronic
1073877741 10:107945254-107945276 TTCTGCCTGTAGAGGGGAAGAGG - Intergenic
1077294556 11:1819651-1819673 CTCTGCTTTTACAGGGCTCATGG + Intergenic
1079002572 11:16770254-16770276 CTCTGCTCCTAGAGAGCTCGCGG + Intergenic
1079477799 11:20849480-20849502 CTCTCCTGGTAGAGAGGTCATGG - Intronic
1079609810 11:22417936-22417958 CTCTGCTTGGTCAGGGGTGGAGG + Intergenic
1080339256 11:31240547-31240569 CTCTGCTTGCAGAGAGGAAGGGG - Intronic
1085505220 11:77054963-77054985 CTCTGCTAATCTAGGGGTCGGGG + Intergenic
1086207930 11:84282631-84282653 GTCTCCTTGAAGAGGGGTTGGGG + Intronic
1086303851 11:85459306-85459328 CTCTGCTTGTTGAGGAGTGGGGG + Intronic
1088139225 11:106595554-106595576 CTTTTTTTGTAGAGGGGTGGGGG + Intergenic
1091204830 11:133813008-133813030 CTCCCCTTGTAGAGGGGCCTTGG - Intergenic
1091665990 12:2418857-2418879 CACTGCTTGTAGAGGGGATTGGG + Intronic
1095691504 12:45094510-45094532 CTCTTCTTGAAGTGGGGTGGGGG + Intergenic
1100378331 12:94038441-94038463 CTCAGCTTCTAGAGGGGCCTCGG + Intergenic
1102236977 12:111299526-111299548 CACTGCTTCTATAGGGGTAGGGG - Intronic
1103338278 12:120206599-120206621 CTCTGATTGTAAAGGTGTCCAGG - Intergenic
1104746647 12:131215123-131215145 CTCTGCTGGAAGAGGGTTCTGGG - Intergenic
1104785912 12:131447791-131447813 CTCTGCTGGAAGAGGGTTCTGGG + Intergenic
1107345426 13:39455081-39455103 ATCTGCTTGTACATGGGTCATGG + Intronic
1113011157 13:105767763-105767785 CTTGGCTTGCAGAGTGGTCGTGG + Intergenic
1113363074 13:109649288-109649310 CTGTGCATGTAGAGGGGAAGGGG + Intergenic
1121097669 14:91229163-91229185 CTCTCCCTGTAGCGGGGTCAGGG - Intergenic
1121539277 14:94712909-94712931 CACTGCTTGTGGAGGGGCGGGGG + Intergenic
1122322802 14:100865788-100865810 CTCAGCTTGTAGAGGAATCAGGG + Intergenic
1129173281 15:73821130-73821152 CTCTGCTGGAAGAGGGAGCGTGG - Intergenic
1130316543 15:82801427-82801449 CTCTGATGGTAGACGGGTTGGGG + Intronic
1134212815 16:12292046-12292068 ATCTGCTGGTGGAGGGGTTGTGG + Intronic
1135475589 16:22771756-22771778 CTCTGCTTGGAGTGGGGGTGGGG - Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1140317899 16:73917141-73917163 CTCTGCTTGTAAATGGGTACTGG - Intergenic
1146983380 17:37187967-37187989 CTCTTTTTTTAGAGGGCTCGTGG - Intronic
1150565285 17:66333610-66333632 CTGTGCTTGTGAAGGGGTCTGGG + Intronic
1155243418 18:23884876-23884898 CTCAGCCTGCAGAGGGGGCGGGG + Intronic
1156181598 18:34611846-34611868 CTCCGCTGGCAGAGGGGTCTCGG + Intronic
1159253560 18:65914851-65914873 CTGTGCTTGTAGAGTGTTGGTGG - Intergenic
1159806530 18:72964032-72964054 CTCTGGTTGAACAGGGGTCCTGG + Intergenic
1164259074 19:23553504-23553526 TTCTGCTTGTTGAGAGGTAGTGG - Intronic
1164649369 19:29880936-29880958 CTCAGCTTCTAGAGGGGTAGCGG + Intergenic
1167631799 19:50630136-50630158 GTCTGCTGGGTGAGGGGTCGGGG + Exonic
937925896 2:127166981-127167003 CTCTGTGTGTAGAATGGTCGGGG + Intergenic
938027305 2:127961252-127961274 CTCAGCTGCTAGAGGGGTTGGGG - Intronic
939514423 2:143148798-143148820 CTCAGCTTACAGAGTGGTCGGGG + Intronic
941867902 2:170353642-170353664 CTGTGCGTGTAGGGGGGCCGGGG + Intronic
943635427 2:190301552-190301574 CTCTGCATGTATTGGGGTGGTGG + Intronic
947416007 2:229897052-229897074 CTATGCATGTTGAGGGGTAGAGG + Intronic
1172653986 20:36525773-36525795 CCCTGCTTGTTGGGGGGTTGGGG + Intronic
1173912913 20:46683628-46683650 CTCTGCTACAAGAGGGGTCCTGG - Intronic
1181165309 22:20980008-20980030 CTCTCCTTGCAGAGGCGACGAGG + Exonic
1182576302 22:31275375-31275397 CTGTGCTTGCAGAGGGCTCAGGG - Intronic
950805877 3:15602778-15602800 CTCTGCTTGGGGTGGGGTTGAGG - Intronic
960042474 3:113164519-113164541 CTGGGCCTGTAGAGGGGTGGGGG + Intergenic
960151052 3:114249265-114249287 CTCTGCTTCTTGAGGGCTCGTGG - Intergenic
963200051 3:142577436-142577458 CTCTTCTTTTAGAGAGGTAGAGG + Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968578484 4:1378869-1378891 CTCTGCCTGTAGTGGGGCCAAGG + Intronic
968684071 4:1944520-1944542 CTGTGCTTGGAGAGGGGAGGTGG + Intronic
969113623 4:4858454-4858476 ATCTGCCTGAAGCGGGGTCGGGG - Intergenic
976146557 4:82046908-82046930 CTCTGCTTCTAGAGGCTTCCTGG + Intergenic
978514563 4:109557387-109557409 CTCTGCTTGCAGGGAGGTTGAGG + Intergenic
986024602 5:3838743-3838765 CTCTGCTGGGGGAGGGGTGGCGG + Intergenic
987033167 5:13994278-13994300 CTTTGCTTGTTGGGGGCTCGGGG - Intergenic
987975166 5:25006060-25006082 CTCTGCTTGTGGAGGGCTTGAGG + Intergenic
988525293 5:31982039-31982061 CTCAGCATGGAGAGGGGTCAGGG - Intronic
989313360 5:40047687-40047709 CACTACTTGAAGAGGGGTAGAGG + Intergenic
993733844 5:91452280-91452302 TTCTGCCTGTAGAAGGGTAGAGG + Intergenic
998093156 5:139382564-139382586 CTCTGTGGGTAGCGGGGTCGAGG + Exonic
1003602079 6:7526882-7526904 CTCTGCCTGTGGTGGGGCCGAGG + Intergenic
1007034675 6:38662361-38662383 CTCTGCTTGTCTAGAGGTCCTGG - Intergenic
1007396141 6:41578858-41578880 CTCTGCTGGGGGAGGGGTGGGGG - Intronic
1007418768 6:41706958-41706980 CTCTGCATGTGATGGGGTCGGGG + Intronic
1007621166 6:43215489-43215511 CTCTGATTGGAAAGGGGTGGTGG - Intronic
1016734521 6:147462145-147462167 CTGTGCCTGTTGTGGGGTCGGGG + Intergenic
1017013335 6:150079914-150079936 CTCTGGTTGTAAAGGAGTCTGGG + Intergenic
1018695311 6:166386373-166386395 GTCTGCTTGTAGAAGGGGCTGGG + Intergenic
1021712254 7:23427443-23427465 CTCTGCTTTAAGAGGAGTCCAGG + Intronic
1022420883 7:30222568-30222590 CTCTGCTTGGAGAGGGTGAGTGG + Intergenic
1022466949 7:30658400-30658422 CCCTGCTTGCAGAGGGCTTGTGG + Intronic
1023120143 7:36900918-36900940 TTCTGCCTGCAGAGGGGTCTGGG + Intronic
1028798907 7:94938226-94938248 CTCTGCATGTGGAGGGATCTAGG + Intronic
1029221437 7:98993765-98993787 GGCTCCTTGTAGAGGGGACGTGG + Intronic
1030348042 7:108455612-108455634 CGCTGCCTGGAGAGGGCTCGGGG - Intronic
1033521421 7:142164851-142164873 CTTTGCTTGTAGATGGTTCTGGG - Intronic
1035339562 7:158151557-158151579 CTCTGCCTGTGGTGGGGTGGTGG + Intronic
1041707048 8:60857687-60857709 CACTGCTTGAAGAAGGGTCCAGG - Intronic
1043148484 8:76683242-76683264 CTCTGTGTGTGTAGGGGTCGAGG - Intronic
1044764690 8:95559016-95559038 CTTTCCTTGTAAAGGGGTGGTGG + Intergenic
1045342673 8:101268415-101268437 CTCTGCTTCTATAGGGGAAGTGG + Intergenic
1047175496 8:122536755-122536777 CTCTGCTTTTAGATGGGTGCTGG - Intergenic
1047738038 8:127783872-127783894 ATCTGCTTGTGGAGTGGTCATGG - Intergenic
1048688330 8:136929443-136929465 CTCTGATTGGAGAGGGGTAGGGG + Intergenic
1049236875 8:141516701-141516723 CTCTGCTTGTAGAGGGGTCGAGG - Intronic
1052997528 9:34559178-34559200 CTATGCTTGTAGAGTGGCCATGG + Intronic
1057307302 9:93919879-93919901 CTCTGCTTGGAGGGGGTTGGGGG - Intergenic
1060823346 9:126673760-126673782 ATCTGCTTGTGCAGGGGTGGTGG + Intronic
1061033655 9:128101684-128101706 CTGTGCGTGTGGAGGGGGCGGGG + Intronic
1061795544 9:133083884-133083906 CTTTGCTTCTAGCGGGGCCGTGG - Intronic
1193607233 X:83583658-83583680 CTCTGCTTGTTGGGGAGTAGGGG - Intergenic
1194234991 X:91372287-91372309 CTCTGCTTGTTGAGGAGCAGGGG - Intergenic
1200123978 X:153804643-153804665 CTCTGCTGGCCGAGGGGGCGGGG - Exonic