ID: 1049237442

View in Genome Browser
Species Human (GRCh38)
Location 8:141519160-141519182
Sequence AGGGGGCAGCAGGATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049237428_1049237442 11 Left 1049237428 8:141519126-141519148 CCAAGTCTGGCAGCTTTCCCGTT No data
Right 1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG No data
1049237434_1049237442 -7 Left 1049237434 8:141519144-141519166 CCGTTTCCCATGATAGAGGGGGC No data
Right 1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG No data
1049237426_1049237442 24 Left 1049237426 8:141519113-141519135 CCACATGCAGACACCAAGTCTGG No data
Right 1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG No data
1049237432_1049237442 -6 Left 1049237432 8:141519143-141519165 CCCGTTTCCCATGATAGAGGGGG No data
Right 1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049237442 Original CRISPR AGGGGGCAGCAGGATGGGGA GGG Intergenic
No off target data available for this crispr