ID: 1049241666

View in Genome Browser
Species Human (GRCh38)
Location 8:141540481-141540503
Sequence CAGGAGGGACACCTTGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049241666_1049241679 20 Left 1049241666 8:141540481-141540503 CCCAGATCAAGGTGTCCCTCCTG No data
Right 1049241679 8:141540524-141540546 CTTCTCCCTGCTTCCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049241666 Original CRISPR CAGGAGGGACACCTTGATCT GGG (reversed) Intergenic
No off target data available for this crispr