ID: 1049241679

View in Genome Browser
Species Human (GRCh38)
Location 8:141540524-141540546
Sequence CTTCTCCCTGCTTCCTCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049241674_1049241679 4 Left 1049241674 8:141540497-141540519 CCTCCTGGGGGGACCTGCAGATG No data
Right 1049241679 8:141540524-141540546 CTTCTCCCTGCTTCCTCATGTGG No data
1049241673_1049241679 5 Left 1049241673 8:141540496-141540518 CCCTCCTGGGGGGACCTGCAGAT No data
Right 1049241679 8:141540524-141540546 CTTCTCCCTGCTTCCTCATGTGG No data
1049241667_1049241679 19 Left 1049241667 8:141540482-141540504 CCAGATCAAGGTGTCCCTCCTGG No data
Right 1049241679 8:141540524-141540546 CTTCTCCCTGCTTCCTCATGTGG No data
1049241675_1049241679 1 Left 1049241675 8:141540500-141540522 CCTGGGGGGACCTGCAGATGCCA No data
Right 1049241679 8:141540524-141540546 CTTCTCCCTGCTTCCTCATGTGG No data
1049241666_1049241679 20 Left 1049241666 8:141540481-141540503 CCCAGATCAAGGTGTCCCTCCTG No data
Right 1049241679 8:141540524-141540546 CTTCTCCCTGCTTCCTCATGTGG No data
1049241676_1049241679 -9 Left 1049241676 8:141540510-141540532 CCTGCAGATGCCACCTTCTCCCT No data
Right 1049241679 8:141540524-141540546 CTTCTCCCTGCTTCCTCATGTGG No data
1049241665_1049241679 21 Left 1049241665 8:141540480-141540502 CCCCAGATCAAGGTGTCCCTCCT No data
Right 1049241679 8:141540524-141540546 CTTCTCCCTGCTTCCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049241679 Original CRISPR CTTCTCCCTGCTTCCTCATG TGG Intergenic
No off target data available for this crispr