ID: 1049241858

View in Genome Browser
Species Human (GRCh38)
Location 8:141541856-141541878
Sequence TGGTGGGACAGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049241858_1049241869 -2 Left 1049241858 8:141541856-141541878 CCCTCTGCCCTCCTGTCCCACCA No data
Right 1049241869 8:141541877-141541899 CAGGACAGCCTGGACCCAGGAGG No data
1049241858_1049241867 -5 Left 1049241858 8:141541856-141541878 CCCTCTGCCCTCCTGTCCCACCA No data
Right 1049241867 8:141541874-141541896 CACCAGGACAGCCTGGACCCAGG No data
1049241858_1049241880 27 Left 1049241858 8:141541856-141541878 CCCTCTGCCCTCCTGTCCCACCA No data
Right 1049241880 8:141541906-141541928 ACCTGCTGGAGGCTGGAGGTGGG No data
1049241858_1049241873 13 Left 1049241858 8:141541856-141541878 CCCTCTGCCCTCCTGTCCCACCA No data
Right 1049241873 8:141541892-141541914 CCAGGAGGACTCCCACCTGCTGG No data
1049241858_1049241876 23 Left 1049241858 8:141541856-141541878 CCCTCTGCCCTCCTGTCCCACCA No data
Right 1049241876 8:141541902-141541924 TCCCACCTGCTGGAGGCTGGAGG No data
1049241858_1049241879 26 Left 1049241858 8:141541856-141541878 CCCTCTGCCCTCCTGTCCCACCA No data
Right 1049241879 8:141541905-141541927 CACCTGCTGGAGGCTGGAGGTGG No data
1049241858_1049241874 16 Left 1049241858 8:141541856-141541878 CCCTCTGCCCTCCTGTCCCACCA No data
Right 1049241874 8:141541895-141541917 GGAGGACTCCCACCTGCTGGAGG No data
1049241858_1049241875 20 Left 1049241858 8:141541856-141541878 CCCTCTGCCCTCCTGTCCCACCA No data
Right 1049241875 8:141541899-141541921 GACTCCCACCTGCTGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049241858 Original CRISPR TGGTGGGACAGGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr