ID: 1049243480

View in Genome Browser
Species Human (GRCh38)
Location 8:141550224-141550246
Sequence TCACCGTGCTTGGCAGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049243480_1049243486 -8 Left 1049243480 8:141550224-141550246 CCTGTATCTGCCAAGCACGGTGA No data
Right 1049243486 8:141550239-141550261 CACGGTGATCCAGTGGGTCGGGG No data
1049243480_1049243493 30 Left 1049243480 8:141550224-141550246 CCTGTATCTGCCAAGCACGGTGA No data
Right 1049243493 8:141550277-141550299 AAACCAGGTGAGCAGGGAGGAGG No data
1049243480_1049243484 -10 Left 1049243480 8:141550224-141550246 CCTGTATCTGCCAAGCACGGTGA No data
Right 1049243484 8:141550237-141550259 AGCACGGTGATCCAGTGGGTCGG No data
1049243480_1049243490 23 Left 1049243480 8:141550224-141550246 CCTGTATCTGCCAAGCACGGTGA No data
Right 1049243490 8:141550270-141550292 AGAAGACAAACCAGGTGAGCAGG No data
1049243480_1049243487 -5 Left 1049243480 8:141550224-141550246 CCTGTATCTGCCAAGCACGGTGA No data
Right 1049243487 8:141550242-141550264 GGTGATCCAGTGGGTCGGGGTGG No data
1049243480_1049243491 24 Left 1049243480 8:141550224-141550246 CCTGTATCTGCCAAGCACGGTGA No data
Right 1049243491 8:141550271-141550293 GAAGACAAACCAGGTGAGCAGGG No data
1049243480_1049243492 27 Left 1049243480 8:141550224-141550246 CCTGTATCTGCCAAGCACGGTGA No data
Right 1049243492 8:141550274-141550296 GACAAACCAGGTGAGCAGGGAGG No data
1049243480_1049243485 -9 Left 1049243480 8:141550224-141550246 CCTGTATCTGCCAAGCACGGTGA No data
Right 1049243485 8:141550238-141550260 GCACGGTGATCCAGTGGGTCGGG No data
1049243480_1049243489 15 Left 1049243480 8:141550224-141550246 CCTGTATCTGCCAAGCACGGTGA No data
Right 1049243489 8:141550262-141550284 TGGACATCAGAAGACAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049243480 Original CRISPR TCACCGTGCTTGGCAGATAC AGG (reversed) Intergenic
No off target data available for this crispr