ID: 1049245720

View in Genome Browser
Species Human (GRCh38)
Location 8:141561274-141561296
Sequence TGGCCATCCAGGGCCTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049245720_1049245724 -8 Left 1049245720 8:141561274-141561296 CCCATGGAGGCCCTGGATGGCCA No data
Right 1049245724 8:141561289-141561311 GATGGCCATGCTGCTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049245720 Original CRISPR TGGCCATCCAGGGCCTCCAT GGG (reversed) Intergenic
No off target data available for this crispr