ID: 1049246092

View in Genome Browser
Species Human (GRCh38)
Location 8:141563328-141563350
Sequence CAGGCACGTTTCCCTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049246092_1049246097 8 Left 1049246092 8:141563328-141563350 CCTCCCACAGGGAAACGTGCCTG No data
Right 1049246097 8:141563359-141563381 ATTGATGTTGCTCTTAATGACGG No data
1049246092_1049246098 17 Left 1049246092 8:141563328-141563350 CCTCCCACAGGGAAACGTGCCTG No data
Right 1049246098 8:141563368-141563390 GCTCTTAATGACGGAAATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049246092 Original CRISPR CAGGCACGTTTCCCTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr