ID: 1049253302

View in Genome Browser
Species Human (GRCh38)
Location 8:141600828-141600850
Sequence CTGCATGTGTAGAGGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049253302_1049253308 8 Left 1049253302 8:141600828-141600850 CCAGGCACCCTCTACACATGCAG No data
Right 1049253308 8:141600859-141600881 AGGCCTGCTCTACTTCTTCTGGG No data
1049253302_1049253310 16 Left 1049253302 8:141600828-141600850 CCAGGCACCCTCTACACATGCAG No data
Right 1049253310 8:141600867-141600889 TCTACTTCTTCTGGGCTGTGTGG No data
1049253302_1049253311 22 Left 1049253302 8:141600828-141600850 CCAGGCACCCTCTACACATGCAG No data
Right 1049253311 8:141600873-141600895 TCTTCTGGGCTGTGTGGTTCTGG No data
1049253302_1049253307 7 Left 1049253302 8:141600828-141600850 CCAGGCACCCTCTACACATGCAG No data
Right 1049253307 8:141600858-141600880 CAGGCCTGCTCTACTTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049253302 Original CRISPR CTGCATGTGTAGAGGGTGCC TGG (reversed) Intergenic
No off target data available for this crispr