ID: 1049254118

View in Genome Browser
Species Human (GRCh38)
Location 8:141604894-141604916
Sequence GACCCTCTGGCGGCCTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049254118_1049254126 -8 Left 1049254118 8:141604894-141604916 CCCAGAAAGGCCGCCAGAGGGTC No data
Right 1049254126 8:141604909-141604931 AGAGGGTCTGGAGTGAGGAGGGG No data
1049254118_1049254124 -10 Left 1049254118 8:141604894-141604916 CCCAGAAAGGCCGCCAGAGGGTC No data
Right 1049254124 8:141604907-141604929 CCAGAGGGTCTGGAGTGAGGAGG No data
1049254118_1049254128 6 Left 1049254118 8:141604894-141604916 CCCAGAAAGGCCGCCAGAGGGTC No data
Right 1049254128 8:141604923-141604945 GAGGAGGGGGCAGAAGCACCAGG No data
1049254118_1049254131 28 Left 1049254118 8:141604894-141604916 CCCAGAAAGGCCGCCAGAGGGTC No data
Right 1049254131 8:141604945-141604967 GCCCTTGGCTGTGTGTTCCGTGG No data
1049254118_1049254125 -9 Left 1049254118 8:141604894-141604916 CCCAGAAAGGCCGCCAGAGGGTC No data
Right 1049254125 8:141604908-141604930 CAGAGGGTCTGGAGTGAGGAGGG No data
1049254118_1049254133 29 Left 1049254118 8:141604894-141604916 CCCAGAAAGGCCGCCAGAGGGTC No data
Right 1049254133 8:141604946-141604968 CCCTTGGCTGTGTGTTCCGTGGG No data
1049254118_1049254129 13 Left 1049254118 8:141604894-141604916 CCCAGAAAGGCCGCCAGAGGGTC No data
Right 1049254129 8:141604930-141604952 GGGCAGAAGCACCAGGCCCTTGG No data
1049254118_1049254127 -7 Left 1049254118 8:141604894-141604916 CCCAGAAAGGCCGCCAGAGGGTC No data
Right 1049254127 8:141604910-141604932 GAGGGTCTGGAGTGAGGAGGGGG No data
1049254118_1049254135 30 Left 1049254118 8:141604894-141604916 CCCAGAAAGGCCGCCAGAGGGTC No data
Right 1049254135 8:141604947-141604969 CCTTGGCTGTGTGTTCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049254118 Original CRISPR GACCCTCTGGCGGCCTTTCT GGG (reversed) Intergenic
No off target data available for this crispr