ID: 1049254121

View in Genome Browser
Species Human (GRCh38)
Location 8:141604904-141604926
Sequence CCTCACTCCAGACCCTCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049254121_1049254129 3 Left 1049254121 8:141604904-141604926 CCGCCAGAGGGTCTGGAGTGAGG No data
Right 1049254129 8:141604930-141604952 GGGCAGAAGCACCAGGCCCTTGG No data
1049254121_1049254128 -4 Left 1049254121 8:141604904-141604926 CCGCCAGAGGGTCTGGAGTGAGG No data
Right 1049254128 8:141604923-141604945 GAGGAGGGGGCAGAAGCACCAGG No data
1049254121_1049254135 20 Left 1049254121 8:141604904-141604926 CCGCCAGAGGGTCTGGAGTGAGG No data
Right 1049254135 8:141604947-141604969 CCTTGGCTGTGTGTTCCGTGGGG No data
1049254121_1049254131 18 Left 1049254121 8:141604904-141604926 CCGCCAGAGGGTCTGGAGTGAGG No data
Right 1049254131 8:141604945-141604967 GCCCTTGGCTGTGTGTTCCGTGG No data
1049254121_1049254133 19 Left 1049254121 8:141604904-141604926 CCGCCAGAGGGTCTGGAGTGAGG No data
Right 1049254133 8:141604946-141604968 CCCTTGGCTGTGTGTTCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049254121 Original CRISPR CCTCACTCCAGACCCTCTGG CGG (reversed) Intergenic
No off target data available for this crispr