ID: 1049254131

View in Genome Browser
Species Human (GRCh38)
Location 8:141604945-141604967
Sequence GCCCTTGGCTGTGTGTTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049254123_1049254131 15 Left 1049254123 8:141604907-141604929 CCAGAGGGTCTGGAGTGAGGAGG No data
Right 1049254131 8:141604945-141604967 GCCCTTGGCTGTGTGTTCCGTGG No data
1049254119_1049254131 27 Left 1049254119 8:141604895-141604917 CCAGAAAGGCCGCCAGAGGGTCT No data
Right 1049254131 8:141604945-141604967 GCCCTTGGCTGTGTGTTCCGTGG No data
1049254118_1049254131 28 Left 1049254118 8:141604894-141604916 CCCAGAAAGGCCGCCAGAGGGTC No data
Right 1049254131 8:141604945-141604967 GCCCTTGGCTGTGTGTTCCGTGG No data
1049254121_1049254131 18 Left 1049254121 8:141604904-141604926 CCGCCAGAGGGTCTGGAGTGAGG No data
Right 1049254131 8:141604945-141604967 GCCCTTGGCTGTGTGTTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049254131 Original CRISPR GCCCTTGGCTGTGTGTTCCG TGG Intergenic
No off target data available for this crispr