ID: 1049256597

View in Genome Browser
Species Human (GRCh38)
Location 8:141617391-141617413
Sequence CCACATGTGTTGAGCCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049256597_1049256602 9 Left 1049256597 8:141617391-141617413 CCAAGCAGGCTCAACACATGTGG No data
Right 1049256602 8:141617423-141617445 AACACAACCAGATGGTGCAAGGG No data
1049256597_1049256601 8 Left 1049256597 8:141617391-141617413 CCAAGCAGGCTCAACACATGTGG No data
Right 1049256601 8:141617422-141617444 AAACACAACCAGATGGTGCAAGG No data
1049256597_1049256600 1 Left 1049256597 8:141617391-141617413 CCAAGCAGGCTCAACACATGTGG No data
Right 1049256600 8:141617415-141617437 TCATGGCAAACACAACCAGATGG No data
1049256597_1049256603 10 Left 1049256597 8:141617391-141617413 CCAAGCAGGCTCAACACATGTGG No data
Right 1049256603 8:141617424-141617446 ACACAACCAGATGGTGCAAGGGG No data
1049256597_1049256607 30 Left 1049256597 8:141617391-141617413 CCAAGCAGGCTCAACACATGTGG No data
Right 1049256607 8:141617444-141617466 GGGAGGCTTCCAAGACTTCAGGG No data
1049256597_1049256606 29 Left 1049256597 8:141617391-141617413 CCAAGCAGGCTCAACACATGTGG No data
Right 1049256606 8:141617443-141617465 GGGGAGGCTTCCAAGACTTCAGG No data
1049256597_1049256604 13 Left 1049256597 8:141617391-141617413 CCAAGCAGGCTCAACACATGTGG No data
Right 1049256604 8:141617427-141617449 CAACCAGATGGTGCAAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049256597 Original CRISPR CCACATGTGTTGAGCCTGCT TGG (reversed) Intergenic
No off target data available for this crispr