ID: 1049256984

View in Genome Browser
Species Human (GRCh38)
Location 8:141619418-141619440
Sequence CTGTATGAGAAGCAGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049256984_1049256993 29 Left 1049256984 8:141619418-141619440 CCTCCCAGCTGCTTCTCATACAG No data
Right 1049256993 8:141619470-141619492 AAGAGTAATTCCCAGGGGATGGG No data
1049256984_1049256994 30 Left 1049256984 8:141619418-141619440 CCTCCCAGCTGCTTCTCATACAG No data
Right 1049256994 8:141619471-141619493 AGAGTAATTCCCAGGGGATGGGG No data
1049256984_1049256990 23 Left 1049256984 8:141619418-141619440 CCTCCCAGCTGCTTCTCATACAG No data
Right 1049256990 8:141619464-141619486 TAATCAAAGAGTAATTCCCAGGG No data
1049256984_1049256988 -1 Left 1049256984 8:141619418-141619440 CCTCCCAGCTGCTTCTCATACAG No data
Right 1049256988 8:141619440-141619462 GGAGTCAATATCAGATCAGTTGG No data
1049256984_1049256992 28 Left 1049256984 8:141619418-141619440 CCTCCCAGCTGCTTCTCATACAG No data
Right 1049256992 8:141619469-141619491 AAAGAGTAATTCCCAGGGGATGG No data
1049256984_1049256989 22 Left 1049256984 8:141619418-141619440 CCTCCCAGCTGCTTCTCATACAG No data
Right 1049256989 8:141619463-141619485 CTAATCAAAGAGTAATTCCCAGG No data
1049256984_1049256991 24 Left 1049256984 8:141619418-141619440 CCTCCCAGCTGCTTCTCATACAG No data
Right 1049256991 8:141619465-141619487 AATCAAAGAGTAATTCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049256984 Original CRISPR CTGTATGAGAAGCAGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr