ID: 1049258675

View in Genome Browser
Species Human (GRCh38)
Location 8:141627257-141627279
Sequence CCATGGACACCCTGCCATCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049258675_1049258680 -7 Left 1049258675 8:141627257-141627279 CCCCGATGGCAGGGTGTCCATGG No data
Right 1049258680 8:141627273-141627295 TCCATGGGACAAGTGAGAAAAGG No data
1049258675_1049258682 20 Left 1049258675 8:141627257-141627279 CCCCGATGGCAGGGTGTCCATGG No data
Right 1049258682 8:141627300-141627322 GAAGAACTGACATTTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049258675 Original CRISPR CCATGGACACCCTGCCATCG GGG (reversed) Intergenic
No off target data available for this crispr