ID: 1049260613

View in Genome Browser
Species Human (GRCh38)
Location 8:141637046-141637068
Sequence TCGGAGGCCAGCACCACGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049260613_1049260625 17 Left 1049260613 8:141637046-141637068 CCCTGCGTGGTGCTGGCCTCCGA No data
Right 1049260625 8:141637086-141637108 CTGCCAGGCCCTTGCTGCCCGGG No data
1049260613_1049260619 -9 Left 1049260613 8:141637046-141637068 CCCTGCGTGGTGCTGGCCTCCGA No data
Right 1049260619 8:141637060-141637082 GGCCTCCGAGAGGGTGAGGGTGG No data
1049260613_1049260623 2 Left 1049260613 8:141637046-141637068 CCCTGCGTGGTGCTGGCCTCCGA No data
Right 1049260623 8:141637071-141637093 GGGTGAGGGTGGGCACTGCCAGG No data
1049260613_1049260627 22 Left 1049260613 8:141637046-141637068 CCCTGCGTGGTGCTGGCCTCCGA No data
Right 1049260627 8:141637091-141637113 AGGCCCTTGCTGCCCGGGCTTGG No data
1049260613_1049260624 16 Left 1049260613 8:141637046-141637068 CCCTGCGTGGTGCTGGCCTCCGA No data
Right 1049260624 8:141637085-141637107 ACTGCCAGGCCCTTGCTGCCCGG No data
1049260613_1049260620 -8 Left 1049260613 8:141637046-141637068 CCCTGCGTGGTGCTGGCCTCCGA No data
Right 1049260620 8:141637061-141637083 GCCTCCGAGAGGGTGAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049260613 Original CRISPR TCGGAGGCCAGCACCACGCA GGG (reversed) Intergenic
No off target data available for this crispr