ID: 1049260622

View in Genome Browser
Species Human (GRCh38)
Location 8:141637065-141637087
Sequence AGTGCCCACCCTCACCCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049260622_1049260624 -3 Left 1049260622 8:141637065-141637087 CCGAGAGGGTGAGGGTGGGCACT No data
Right 1049260624 8:141637085-141637107 ACTGCCAGGCCCTTGCTGCCCGG No data
1049260622_1049260627 3 Left 1049260622 8:141637065-141637087 CCGAGAGGGTGAGGGTGGGCACT No data
Right 1049260627 8:141637091-141637113 AGGCCCTTGCTGCCCGGGCTTGG No data
1049260622_1049260625 -2 Left 1049260622 8:141637065-141637087 CCGAGAGGGTGAGGGTGGGCACT No data
Right 1049260625 8:141637086-141637108 CTGCCAGGCCCTTGCTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049260622 Original CRISPR AGTGCCCACCCTCACCCTCT CGG (reversed) Intergenic
No off target data available for this crispr