ID: 1049260623

View in Genome Browser
Species Human (GRCh38)
Location 8:141637071-141637093
Sequence GGGTGAGGGTGGGCACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049260613_1049260623 2 Left 1049260613 8:141637046-141637068 CCCTGCGTGGTGCTGGCCTCCGA No data
Right 1049260623 8:141637071-141637093 GGGTGAGGGTGGGCACTGCCAGG No data
1049260614_1049260623 1 Left 1049260614 8:141637047-141637069 CCTGCGTGGTGCTGGCCTCCGAG No data
Right 1049260623 8:141637071-141637093 GGGTGAGGGTGGGCACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049260623 Original CRISPR GGGTGAGGGTGGGCACTGCC AGG Intergenic
No off target data available for this crispr