ID: 1049260627

View in Genome Browser
Species Human (GRCh38)
Location 8:141637091-141637113
Sequence AGGCCCTTGCTGCCCGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049260621_1049260627 6 Left 1049260621 8:141637062-141637084 CCTCCGAGAGGGTGAGGGTGGGC No data
Right 1049260627 8:141637091-141637113 AGGCCCTTGCTGCCCGGGCTTGG No data
1049260622_1049260627 3 Left 1049260622 8:141637065-141637087 CCGAGAGGGTGAGGGTGGGCACT No data
Right 1049260627 8:141637091-141637113 AGGCCCTTGCTGCCCGGGCTTGG No data
1049260613_1049260627 22 Left 1049260613 8:141637046-141637068 CCCTGCGTGGTGCTGGCCTCCGA No data
Right 1049260627 8:141637091-141637113 AGGCCCTTGCTGCCCGGGCTTGG No data
1049260614_1049260627 21 Left 1049260614 8:141637047-141637069 CCTGCGTGGTGCTGGCCTCCGAG No data
Right 1049260627 8:141637091-141637113 AGGCCCTTGCTGCCCGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049260627 Original CRISPR AGGCCCTTGCTGCCCGGGCT TGG Intergenic
No off target data available for this crispr