ID: 1049260693

View in Genome Browser
Species Human (GRCh38)
Location 8:141637557-141637579
Sequence GGGCTAGCACAGTGACTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049260688_1049260693 -3 Left 1049260688 8:141637537-141637559 CCCACAGTGGGGACAGGCGAGGG No data
Right 1049260693 8:141637557-141637579 GGGCTAGCACAGTGACTGGGTGG No data
1049260690_1049260693 -4 Left 1049260690 8:141637538-141637560 CCACAGTGGGGACAGGCGAGGGC No data
Right 1049260693 8:141637557-141637579 GGGCTAGCACAGTGACTGGGTGG No data
1049260686_1049260693 -2 Left 1049260686 8:141637536-141637558 CCCCACAGTGGGGACAGGCGAGG No data
Right 1049260693 8:141637557-141637579 GGGCTAGCACAGTGACTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049260693 Original CRISPR GGGCTAGCACAGTGACTGGG TGG Intergenic
No off target data available for this crispr