ID: 1049261366

View in Genome Browser
Species Human (GRCh38)
Location 8:141640910-141640932
Sequence CTGGGGGGCTGCCAGTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049261366_1049261372 -6 Left 1049261366 8:141640910-141640932 CCATCTGACTGGCAGCCCCCCAG No data
Right 1049261372 8:141640927-141640949 CCCCAGCGGCAGTCCCAGGCAGG No data
1049261366_1049261377 19 Left 1049261366 8:141640910-141640932 CCATCTGACTGGCAGCCCCCCAG No data
Right 1049261377 8:141640952-141640974 ACTGTGCCACTTGCTCATCGTGG No data
1049261366_1049261368 -10 Left 1049261366 8:141640910-141640932 CCATCTGACTGGCAGCCCCCCAG No data
Right 1049261368 8:141640923-141640945 AGCCCCCCAGCGGCAGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049261366 Original CRISPR CTGGGGGGCTGCCAGTCAGA TGG (reversed) Intergenic
No off target data available for this crispr