ID: 1049261628

View in Genome Browser
Species Human (GRCh38)
Location 8:141642076-141642098
Sequence CAGGGCAAGAAGGGGGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049261618_1049261628 11 Left 1049261618 8:141642042-141642064 CCAGCTTCTTCCGCAGAGAGAGT No data
Right 1049261628 8:141642076-141642098 CAGGGCAAGAAGGGGGCCGCAGG No data
1049261616_1049261628 13 Left 1049261616 8:141642040-141642062 CCCCAGCTTCTTCCGCAGAGAGA No data
Right 1049261628 8:141642076-141642098 CAGGGCAAGAAGGGGGCCGCAGG No data
1049261619_1049261628 1 Left 1049261619 8:141642052-141642074 CCGCAGAGAGAGTGCTCCTCACC No data
Right 1049261628 8:141642076-141642098 CAGGGCAAGAAGGGGGCCGCAGG No data
1049261617_1049261628 12 Left 1049261617 8:141642041-141642063 CCCAGCTTCTTCCGCAGAGAGAG No data
Right 1049261628 8:141642076-141642098 CAGGGCAAGAAGGGGGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049261628 Original CRISPR CAGGGCAAGAAGGGGGCCGC AGG Intergenic
No off target data available for this crispr