ID: 1049264067

View in Genome Browser
Species Human (GRCh38)
Location 8:141657462-141657484
Sequence TCAGGGCCACACATACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049264060_1049264067 9 Left 1049264060 8:141657430-141657452 CCCCACATCAGCAGAGATGGGGG No data
Right 1049264067 8:141657462-141657484 TCAGGGCCACACATACAGCCTGG No data
1049264063_1049264067 7 Left 1049264063 8:141657432-141657454 CCACATCAGCAGAGATGGGGGCA No data
Right 1049264067 8:141657462-141657484 TCAGGGCCACACATACAGCCTGG No data
1049264062_1049264067 8 Left 1049264062 8:141657431-141657453 CCCACATCAGCAGAGATGGGGGC No data
Right 1049264067 8:141657462-141657484 TCAGGGCCACACATACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049264067 Original CRISPR TCAGGGCCACACATACAGCC TGG Intergenic
No off target data available for this crispr