ID: 1049264136

View in Genome Browser
Species Human (GRCh38)
Location 8:141657830-141657852
Sequence TAATCGGGGATTGCAGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049264127_1049264136 10 Left 1049264127 8:141657797-141657819 CCCCTGGCTAGACCTTTCACTAT No data
Right 1049264136 8:141657830-141657852 TAATCGGGGATTGCAGCTACTGG No data
1049264126_1049264136 11 Left 1049264126 8:141657796-141657818 CCCCCTGGCTAGACCTTTCACTA No data
Right 1049264136 8:141657830-141657852 TAATCGGGGATTGCAGCTACTGG No data
1049264123_1049264136 30 Left 1049264123 8:141657777-141657799 CCTGGTGGCTCCAGCAGTGCCCC No data
Right 1049264136 8:141657830-141657852 TAATCGGGGATTGCAGCTACTGG No data
1049264125_1049264136 20 Left 1049264125 8:141657787-141657809 CCAGCAGTGCCCCCTGGCTAGAC No data
Right 1049264136 8:141657830-141657852 TAATCGGGGATTGCAGCTACTGG No data
1049264132_1049264136 -2 Left 1049264132 8:141657809-141657831 CCTTTCACTATGCTGGGCTTCTA No data
Right 1049264136 8:141657830-141657852 TAATCGGGGATTGCAGCTACTGG No data
1049264129_1049264136 8 Left 1049264129 8:141657799-141657821 CCTGGCTAGACCTTTCACTATGC No data
Right 1049264136 8:141657830-141657852 TAATCGGGGATTGCAGCTACTGG No data
1049264128_1049264136 9 Left 1049264128 8:141657798-141657820 CCCTGGCTAGACCTTTCACTATG No data
Right 1049264136 8:141657830-141657852 TAATCGGGGATTGCAGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049264136 Original CRISPR TAATCGGGGATTGCAGCTAC TGG Intergenic
No off target data available for this crispr