ID: 1049264248

View in Genome Browser
Species Human (GRCh38)
Location 8:141658832-141658854
Sequence ACGTGGATGGGTCAGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049264248_1049264254 -6 Left 1049264248 8:141658832-141658854 CCCCATCACTGACCCATCCACGT No data
Right 1049264254 8:141658849-141658871 CCACGTGAATGTTCTTTCTTTGG No data
1049264248_1049264256 19 Left 1049264248 8:141658832-141658854 CCCCATCACTGACCCATCCACGT No data
Right 1049264256 8:141658874-141658896 ATCGTGCAGCCAAATGTGGATGG No data
1049264248_1049264255 15 Left 1049264248 8:141658832-141658854 CCCCATCACTGACCCATCCACGT No data
Right 1049264255 8:141658870-141658892 GGACATCGTGCAGCCAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049264248 Original CRISPR ACGTGGATGGGTCAGTGATG GGG (reversed) Intergenic
No off target data available for this crispr