ID: 1049264491

View in Genome Browser
Species Human (GRCh38)
Location 8:141660195-141660217
Sequence CCTAACTTGGACAATCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049264484_1049264491 28 Left 1049264484 8:141660144-141660166 CCTCAGCAGCGTTGCTCCTGGTA No data
Right 1049264491 8:141660195-141660217 CCTAACTTGGACAATCTGGCTGG No data
1049264485_1049264491 12 Left 1049264485 8:141660160-141660182 CCTGGTAATTTCTTTGCCTCTCT No data
Right 1049264491 8:141660195-141660217 CCTAACTTGGACAATCTGGCTGG No data
1049264487_1049264491 -4 Left 1049264487 8:141660176-141660198 CCTCTCTTTGCTACGGTTTCCTA No data
Right 1049264491 8:141660195-141660217 CCTAACTTGGACAATCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049264491 Original CRISPR CCTAACTTGGACAATCTGGC TGG Intergenic
No off target data available for this crispr