ID: 1049265169

View in Genome Browser
Species Human (GRCh38)
Location 8:141664042-141664064
Sequence AGGCCACATCCAGCCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049265169_1049265172 -8 Left 1049265169 8:141664042-141664064 CCTGCTGGGGCTGGATGTGGCCT No data
Right 1049265172 8:141664057-141664079 TGTGGCCTCCCTGCTGGGCCTGG No data
1049265169_1049265173 -7 Left 1049265169 8:141664042-141664064 CCTGCTGGGGCTGGATGTGGCCT No data
Right 1049265173 8:141664058-141664080 GTGGCCTCCCTGCTGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049265169 Original CRISPR AGGCCACATCCAGCCCCAGC AGG (reversed) Intergenic
No off target data available for this crispr