ID: 1049265172

View in Genome Browser
Species Human (GRCh38)
Location 8:141664057-141664079
Sequence TGTGGCCTCCCTGCTGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049265168_1049265172 -7 Left 1049265168 8:141664041-141664063 CCCTGCTGGGGCTGGATGTGGCC No data
Right 1049265172 8:141664057-141664079 TGTGGCCTCCCTGCTGGGCCTGG No data
1049265158_1049265172 26 Left 1049265158 8:141664008-141664030 CCAGCCTTGCTCAAGGGGGGCTG No data
Right 1049265172 8:141664057-141664079 TGTGGCCTCCCTGCTGGGCCTGG No data
1049265166_1049265172 -4 Left 1049265166 8:141664038-141664060 CCTCCCTGCTGGGGCTGGATGTG No data
Right 1049265172 8:141664057-141664079 TGTGGCCTCCCTGCTGGGCCTGG No data
1049265157_1049265172 27 Left 1049265157 8:141664007-141664029 CCCAGCCTTGCTCAAGGGGGGCT No data
Right 1049265172 8:141664057-141664079 TGTGGCCTCCCTGCTGGGCCTGG No data
1049265160_1049265172 22 Left 1049265160 8:141664012-141664034 CCTTGCTCAAGGGGGGCTGGATG No data
Right 1049265172 8:141664057-141664079 TGTGGCCTCCCTGCTGGGCCTGG No data
1049265169_1049265172 -8 Left 1049265169 8:141664042-141664064 CCTGCTGGGGCTGGATGTGGCCT No data
Right 1049265172 8:141664057-141664079 TGTGGCCTCCCTGCTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049265172 Original CRISPR TGTGGCCTCCCTGCTGGGCC TGG Intergenic
No off target data available for this crispr